Incidental Mutation 'R6560:Dscam'
ID 522042
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik, Down syndrome cell adhesion molecule
MMRRC Submission 044684-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6560 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 96392040-96971952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96626935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 325 (S325G)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: S325G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: S325G

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,843,230 (GRCm39) L1235Q probably damaging Het
Acin1 T C 14: 54,916,290 (GRCm39) T174A probably benign Het
Adamtsl1 G A 4: 86,255,130 (GRCm39) R733H probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arsk A T 13: 76,223,105 (GRCm39) I164N probably benign Het
Bbs5 T A 2: 69,487,300 (GRCm39) N194K probably damaging Het
Bicra T C 7: 15,723,119 (GRCm39) T133A possibly damaging Het
Card6 G A 15: 5,128,367 (GRCm39) P1010S probably damaging Het
Ccdc18 T A 5: 108,339,790 (GRCm39) N778K probably benign Het
Cept1 T C 3: 106,412,594 (GRCm39) I240V possibly damaging Het
Crip3 A G 17: 46,741,962 (GRCm39) R150G probably damaging Het
Cyp2c50 A G 19: 40,085,299 (GRCm39) T320A probably benign Het
Dio2 G C 12: 90,696,607 (GRCm39) S127* probably null Het
Dnai3 T C 3: 145,801,161 (GRCm39) E99G possibly damaging Het
Exosc4 A G 15: 76,211,813 (GRCm39) I41V probably benign Het
Glb1l3 C T 9: 26,739,720 (GRCm39) probably null Het
Gm10801 C CGTG 2: 98,494,152 (GRCm39) probably null Het
Gm3072 T A 14: 41,345,510 (GRCm39) D89V unknown Het
Gosr2 T C 11: 103,577,508 (GRCm39) H79R probably damaging Het
Has2 T A 15: 56,531,660 (GRCm39) T352S probably damaging Het
Insig1 T A 5: 28,276,531 (GRCm39) C32* probably null Het
Klf9 A G 19: 23,119,314 (GRCm39) S66G probably damaging Het
Mfn1 T C 3: 32,623,665 (GRCm39) I263T probably damaging Het
Myl2 G A 5: 122,240,834 (GRCm39) G38R probably null Het
Negr1 A G 3: 157,018,494 (GRCm39) T332A probably benign Het
Neo1 A G 9: 58,787,884 (GRCm39) S1417P possibly damaging Het
Or52ab4 T C 7: 102,987,945 (GRCm39) F228S probably benign Het
Or7e168 G A 9: 19,720,412 (GRCm39) S266N probably benign Het
Pcgf3 C A 5: 108,621,768 (GRCm39) H35Q probably damaging Het
Plppr5 A G 3: 117,465,639 (GRCm39) I297V probably benign Het
Plxna4 C T 6: 32,192,613 (GRCm39) V783M probably damaging Het
Prx A T 7: 27,214,746 (GRCm39) Q85H probably damaging Het
Tex14 T G 11: 87,388,688 (GRCm39) M305R possibly damaging Het
Ythdc1 T C 5: 86,964,467 (GRCm39) V92A probably benign Het
Zfp619 G A 7: 39,186,954 (GRCm39) E995K probably damaging Het
Zfp90 A G 8: 107,142,379 (GRCm39) R4G probably damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96,409,265 (GRCm39) missense possibly damaging 0.64
IGL00841:Dscam APN 16 96,621,077 (GRCm39) missense probably damaging 1.00
IGL01289:Dscam APN 16 96,445,082 (GRCm39) nonsense probably null
IGL01358:Dscam APN 16 96,411,543 (GRCm39) missense possibly damaging 0.68
IGL01431:Dscam APN 16 96,453,278 (GRCm39) critical splice donor site probably null
IGL01444:Dscam APN 16 96,474,909 (GRCm39) missense possibly damaging 0.95
IGL01767:Dscam APN 16 96,456,136 (GRCm39) missense probably damaging 1.00
IGL01866:Dscam APN 16 96,486,550 (GRCm39) missense probably benign 0.06
IGL02020:Dscam APN 16 96,517,269 (GRCm39) missense probably damaging 1.00
IGL02023:Dscam APN 16 96,602,397 (GRCm39) missense probably benign 0.06
IGL02057:Dscam APN 16 96,517,273 (GRCm39) nonsense probably null
IGL02389:Dscam APN 16 96,442,097 (GRCm39) missense probably benign 0.27
IGL02409:Dscam APN 16 96,621,088 (GRCm39) missense possibly damaging 0.46
IGL02694:Dscam APN 16 96,394,476 (GRCm39) missense probably benign 0.00
IGL02899:Dscam APN 16 96,510,447 (GRCm39) missense probably damaging 0.98
IGL02956:Dscam APN 16 96,602,472 (GRCm39) missense probably damaging 0.98
IGL03035:Dscam APN 16 96,621,170 (GRCm39) missense possibly damaging 0.94
IGL03191:Dscam APN 16 96,621,969 (GRCm39) missense probably benign 0.36
growler UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
Twostep UTSW 16 96,626,982 (GRCm39) splice site probably null
F6893:Dscam UTSW 16 96,857,660 (GRCm39) missense possibly damaging 0.78
K3955:Dscam UTSW 16 96,474,887 (GRCm39) missense probably benign 0.00
R0024:Dscam UTSW 16 96,394,585 (GRCm39) nonsense probably null
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0117:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R0211:Dscam UTSW 16 96,517,279 (GRCm39) missense possibly damaging 0.50
R0280:Dscam UTSW 16 96,840,206 (GRCm39) missense possibly damaging 0.62
R0355:Dscam UTSW 16 96,456,105 (GRCm39) missense probably benign 0.00
R0380:Dscam UTSW 16 96,857,810 (GRCm39) missense probably damaging 1.00
R0445:Dscam UTSW 16 96,573,703 (GRCm39) missense probably damaging 1.00
R0492:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0534:Dscam UTSW 16 96,453,372 (GRCm39) missense possibly damaging 0.67
R0593:Dscam UTSW 16 96,573,608 (GRCm39) missense probably benign 0.19
R0707:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0738:Dscam UTSW 16 96,620,981 (GRCm39) missense possibly damaging 0.48
R1017:Dscam UTSW 16 96,634,633 (GRCm39) missense probably damaging 1.00
R1377:Dscam UTSW 16 96,573,694 (GRCm39) missense probably damaging 1.00
R1440:Dscam UTSW 16 96,621,151 (GRCm39) missense probably damaging 1.00
R1442:Dscam UTSW 16 96,409,274 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1478:Dscam UTSW 16 96,592,110 (GRCm39) missense probably benign 0.15
R1530:Dscam UTSW 16 96,621,074 (GRCm39) missense probably damaging 1.00
R1731:Dscam UTSW 16 96,621,076 (GRCm39) missense probably damaging 1.00
R1765:Dscam UTSW 16 96,486,579 (GRCm39) missense probably benign 0.00
R1824:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign 0.00
R1933:Dscam UTSW 16 96,394,414 (GRCm39) missense probably benign 0.00
R2005:Dscam UTSW 16 96,840,120 (GRCm39) missense probably benign 0.02
R2006:Dscam UTSW 16 96,621,112 (GRCm39) missense probably damaging 1.00
R2101:Dscam UTSW 16 96,411,549 (GRCm39) missense probably benign 0.00
R2177:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 0.98
R2342:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R2851:Dscam UTSW 16 96,423,915 (GRCm39) missense possibly damaging 0.94
R2929:Dscam UTSW 16 96,486,612 (GRCm39) missense possibly damaging 0.76
R3055:Dscam UTSW 16 96,602,555 (GRCm39) missense probably damaging 1.00
R3157:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3159:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3944:Dscam UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
R4080:Dscam UTSW 16 96,484,972 (GRCm39) missense probably benign 0.01
R4285:Dscam UTSW 16 96,510,309 (GRCm39) critical splice donor site probably null
R4384:Dscam UTSW 16 96,510,416 (GRCm39) missense probably damaging 0.99
R4460:Dscam UTSW 16 96,411,519 (GRCm39) missense probably damaging 1.00
R4575:Dscam UTSW 16 96,626,823 (GRCm39) missense possibly damaging 0.82
R4594:Dscam UTSW 16 96,519,196 (GRCm39) missense possibly damaging 0.78
R4643:Dscam UTSW 16 96,486,501 (GRCm39) missense probably damaging 0.96
R4698:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R4716:Dscam UTSW 16 96,420,771 (GRCm39) missense possibly damaging 0.80
R4743:Dscam UTSW 16 96,631,256 (GRCm39) missense probably benign 0.00
R4766:Dscam UTSW 16 96,445,188 (GRCm39) missense probably benign 0.02
R4899:Dscam UTSW 16 96,485,018 (GRCm39) missense probably benign 0.01
R4987:Dscam UTSW 16 96,498,721 (GRCm39) missense probably benign 0.00
R4990:Dscam UTSW 16 96,626,715 (GRCm39) missense probably benign 0.12
R5123:Dscam UTSW 16 96,573,637 (GRCm39) missense probably damaging 1.00
R5130:Dscam UTSW 16 96,620,979 (GRCm39) missense probably benign 0.00
R5328:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R5666:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5670:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5678:Dscam UTSW 16 96,592,100 (GRCm39) missense probably benign 0.16
R5827:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R5907:Dscam UTSW 16 96,622,120 (GRCm39) missense probably damaging 0.97
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6103:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign
R6240:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R6257:Dscam UTSW 16 96,474,914 (GRCm39) missense possibly damaging 0.94
R6361:Dscam UTSW 16 96,424,011 (GRCm39) missense probably benign 0.08
R6405:Dscam UTSW 16 96,479,625 (GRCm39) missense probably damaging 1.00
R6444:Dscam UTSW 16 96,420,844 (GRCm39) missense probably damaging 1.00
R6598:Dscam UTSW 16 96,620,984 (GRCm39) missense probably damaging 1.00
R6622:Dscam UTSW 16 96,446,273 (GRCm39) missense probably benign 0.06
R6792:Dscam UTSW 16 96,449,437 (GRCm39) missense probably damaging 1.00
R6792:Dscam UTSW 16 96,394,455 (GRCm39) missense probably damaging 0.96
R6827:Dscam UTSW 16 96,840,191 (GRCm39) missense probably damaging 1.00
R6868:Dscam UTSW 16 96,631,140 (GRCm39) missense probably damaging 1.00
R6898:Dscam UTSW 16 96,631,100 (GRCm39) missense probably benign 0.02
R6903:Dscam UTSW 16 96,621,988 (GRCm39) missense probably damaging 1.00
R7051:Dscam UTSW 16 96,620,986 (GRCm39) missense probably benign 0.01
R7146:Dscam UTSW 16 96,631,117 (GRCm39) nonsense probably null
R7180:Dscam UTSW 16 96,626,764 (GRCm39) missense probably damaging 0.97
R7209:Dscam UTSW 16 96,451,544 (GRCm39) splice site probably null
R7247:Dscam UTSW 16 96,622,008 (GRCm39) missense probably damaging 0.99
R7269:Dscam UTSW 16 96,479,601 (GRCm39) missense probably benign 0.00
R7301:Dscam UTSW 16 96,857,732 (GRCm39) missense probably benign 0.01
R7328:Dscam UTSW 16 96,446,235 (GRCm39) nonsense probably null
R7368:Dscam UTSW 16 96,445,131 (GRCm39) missense probably benign 0.00
R7425:Dscam UTSW 16 96,430,598 (GRCm39) missense probably damaging 1.00
R7474:Dscam UTSW 16 96,621,089 (GRCm39) missense possibly damaging 0.88
R7536:Dscam UTSW 16 96,442,226 (GRCm39) splice site probably null
R7624:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R7766:Dscam UTSW 16 96,592,101 (GRCm39) missense probably benign 0.31
R7817:Dscam UTSW 16 96,442,064 (GRCm39) missense probably benign
R7843:Dscam UTSW 16 96,626,830 (GRCm39) missense probably damaging 0.99
R7911:Dscam UTSW 16 96,445,122 (GRCm39) missense probably benign 0.01
R8108:Dscam UTSW 16 96,445,079 (GRCm39) missense probably benign 0.01
R8128:Dscam UTSW 16 96,602,374 (GRCm39) splice site probably null
R8770:Dscam UTSW 16 96,456,106 (GRCm39) missense possibly damaging 0.50
R8876:Dscam UTSW 16 96,420,828 (GRCm39) missense probably damaging 0.96
R9005:Dscam UTSW 16 96,602,580 (GRCm39) missense probably damaging 1.00
R9009:Dscam UTSW 16 96,840,116 (GRCm39) missense probably benign 0.10
R9168:Dscam UTSW 16 96,420,768 (GRCm39) missense possibly damaging 0.82
R9176:Dscam UTSW 16 96,486,553 (GRCm39) missense probably benign 0.37
R9244:Dscam UTSW 16 96,486,429 (GRCm39) missense possibly damaging 0.62
R9339:Dscam UTSW 16 96,517,263 (GRCm39) missense possibly damaging 0.89
R9374:Dscam UTSW 16 96,857,857 (GRCm39) missense probably benign 0.19
R9385:Dscam UTSW 16 96,840,203 (GRCm39) missense probably benign
R9674:Dscam UTSW 16 96,442,036 (GRCm39) missense probably benign 0.03
X0025:Dscam UTSW 16 96,510,361 (GRCm39) missense probably damaging 1.00
Z1088:Dscam UTSW 16 96,573,761 (GRCm39) missense probably benign 0.01
Z1177:Dscam UTSW 16 96,409,389 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCTGGACATAGTCTTGAGC -3'
(R):5'- CACTGATGTGGAACCCTCATG -3'

Sequencing Primer
(F):5'- GATAGCTTGTCCTTGCGCACAAAG -3'
(R):5'- TGGAACCCTCATGAAGAGTCCTG -3'
Posted On 2018-06-06