Incidental Mutation 'R6560:Crip3'
ID522044
Institutional Source Beutler Lab
Gene Symbol Crip3
Ensembl Gene ENSMUSG00000023968
Gene Namecysteine-rich protein 3
SynonymsTLP, TLP-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46428926-46431776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46431036 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 150 (R150G)
Ref Sequence ENSEMBL: ENSMUSP00000024764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024764] [ENSMUST00000087012] [ENSMUST00000113465] [ENSMUST00000165993]
Predicted Effect probably damaging
Transcript: ENSMUST00000024764
AA Change: R150G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024764
Gene: ENSMUSG00000023968
AA Change: R150G

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087012
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113465
AA Change: R150G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109092
Gene: ENSMUSG00000023968
AA Change: R150G

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165811
Predicted Effect probably damaging
Transcript: ENSMUST00000165993
AA Change: R150G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130072
Gene: ENSMUSG00000023968
AA Change: R150G

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169441
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit a decrease in thymocyte cellularity, though thymocyte development and thymic architecture appear to be normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Crip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Crip3 UTSW 17 46430994 missense probably damaging 0.97
R1476:Crip3 UTSW 17 46430776 splice site probably benign
R2197:Crip3 UTSW 17 46429412 missense probably damaging 1.00
R2255:Crip3 UTSW 17 46429372 missense probably damaging 1.00
R4239:Crip3 UTSW 17 46431230 nonsense probably null
R4668:Crip3 UTSW 17 46429364 missense probably damaging 1.00
R4786:Crip3 UTSW 17 46431042 missense possibly damaging 0.77
R4858:Crip3 UTSW 17 46430747 intron probably benign
R5996:Crip3 UTSW 17 46431284 missense possibly damaging 0.46
R7084:Crip3 UTSW 17 46430790 missense probably benign
R7626:Crip3 UTSW 17 46429865 missense probably benign 0.08
X0067:Crip3 UTSW 17 46429827 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTTGGTGAGGAGCACTG -3'
(R):5'- CATTCTCATAGGTCCAGTGTCTG -3'

Sequencing Primer
(F):5'- TGAGGAGCACTGTTGAGGC -3'
(R):5'- TTTGGGGCCAAACAGGTATCC -3'
Posted On2018-06-06