Incidental Mutation 'R6560:Klf9'
ID522046
Institutional Source Beutler Lab
Gene Symbol Klf9
Ensembl Gene ENSMUSG00000033863
Gene NameKruppel-like factor 9
SynonymsBteb1, BTEB-1, Klf9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location23141226-23166911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23141950 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 66 (S66G)
Ref Sequence ENSEMBL: ENSMUSP00000045639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036884]
Predicted Effect probably damaging
Transcript: ENSMUST00000036884
AA Change: S66G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045639
Gene: ENSMUSG00000033863
AA Change: S66G

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
ZnF_C2H2 143 167 1.04e-3 SMART
ZnF_C2H2 173 197 7.37e-4 SMART
ZnF_C2H2 203 225 3.16e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds to GC box elements located in the promoter. Binding of the encoded protein to a single GC box inhibits mRNA expression while binding to tandemly repeated GC box elements activates transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display only mild neurological defects evident by impaired performance in rotarod and contextual fear-conditioning tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Klf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Klf9 APN 19 23142269 splice site probably benign
R0399:Klf9 UTSW 19 23142082 missense probably damaging 0.96
R0528:Klf9 UTSW 19 23142134 missense probably benign 0.00
R1883:Klf9 UTSW 19 23164737 missense probably damaging 1.00
R2113:Klf9 UTSW 19 23164688 missense probably damaging 1.00
R5642:Klf9 UTSW 19 23141882 missense probably benign
R6352:Klf9 UTSW 19 23141774 missense probably benign 0.06
R6618:Klf9 UTSW 19 23164871 missense probably benign 0.11
X0067:Klf9 UTSW 19 23164764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGGACTTCGTGGCTGC -3'
(R):5'- CTTTCCCACAGCCACTGTAG -3'

Sequencing Primer
(F):5'- TTCGTGGCTGCCCAGTGTC -3'
(R):5'- AGGCGTGTTTCCCCTTCGAAG -3'
Posted On2018-06-06