Incidental Mutation 'R6560:Cyp2c50'
ID522048
Institutional Source Beutler Lab
Gene Symbol Cyp2c50
Ensembl Gene ENSMUSG00000054827
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 50
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location40089688-40113950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40096855 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 320 (T320A)
Ref Sequence ENSEMBL: ENSMUSP00000079065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068094] [ENSMUST00000080171]
Predicted Effect probably benign
Transcript: ENSMUST00000068094
AA Change: T261A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000068039
Gene: ENSMUSG00000054827
AA Change: T261A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 225 3.7e-54 PFAM
Pfam:p450 213 428 6.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080171
AA Change: T320A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079065
Gene: ENSMUSG00000054827
AA Change: T320A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Cyp2c50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Cyp2c50 APN 19 40092284 missense probably benign 0.12
IGL01463:Cyp2c50 APN 19 40090978 missense probably damaging 1.00
IGL01669:Cyp2c50 APN 19 40098051 missense probably damaging 1.00
IGL02008:Cyp2c50 APN 19 40091099 nonsense probably null
IGL02331:Cyp2c50 APN 19 40090943 critical splice acceptor site probably null
IGL02830:Cyp2c50 APN 19 40098056 missense probably benign 0.00
R0115:Cyp2c50 UTSW 19 40092393 splice site probably benign
R1666:Cyp2c50 UTSW 19 40091055 missense probably benign
R1668:Cyp2c50 UTSW 19 40091055 missense probably benign
R1679:Cyp2c50 UTSW 19 40111415 missense possibly damaging 0.93
R2425:Cyp2c50 UTSW 19 40089848 missense probably benign 0.20
R2509:Cyp2c50 UTSW 19 40090569 missense probably benign
R2570:Cyp2c50 UTSW 19 40090320 missense probably benign 0.01
R3040:Cyp2c50 UTSW 19 40098126 missense probably benign 0.02
R3983:Cyp2c50 UTSW 19 40113518 missense possibly damaging 0.64
R4425:Cyp2c50 UTSW 19 40090692 missense possibly damaging 0.94
R4484:Cyp2c50 UTSW 19 40090639 missense probably damaging 1.00
R4520:Cyp2c50 UTSW 19 40090689 missense probably benign 0.02
R4820:Cyp2c50 UTSW 19 40113580 missense probably damaging 1.00
R4978:Cyp2c50 UTSW 19 40098057 missense probably damaging 1.00
R5335:Cyp2c50 UTSW 19 40090616 missense probably benign 0.00
R5807:Cyp2c50 UTSW 19 40113500 missense probably damaging 1.00
R5955:Cyp2c50 UTSW 19 40090943 critical splice acceptor site probably null
R6553:Cyp2c50 UTSW 19 40090602 missense probably benign 0.41
R7241:Cyp2c50 UTSW 19 40090568 missense probably benign
R7389:Cyp2c50 UTSW 19 40090663 missense probably benign 0.01
R7511:Cyp2c50 UTSW 19 40092190 splice site probably null
RF008:Cyp2c50 UTSW 19 40089824 missense probably damaging 0.98
Z1088:Cyp2c50 UTSW 19 40097955 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGTTGGCCACAAAATGAAGTTG -3'
(R):5'- CTGGGAACTGAGAACTCATAGTC -3'

Sequencing Primer
(F):5'- GCTTGAACACCTGGCAAT -3'
(R):5'- GGGAACTGAGAACTCATAGTCTCTAC -3'
Posted On2018-06-06