Mutagenetix > Incidental Mutations

Incidental Mutation 'R6528:Arhgap29'

522049

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6528 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 122014702 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1176 (N1176K)

Ref Sequence

ENSEMBL: ENSMUSP00000044624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]

Predicted Effect

probably benign
Transcript: ENSMUST00000037958
AA Change: N1176K

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: N1176K

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197155

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000198914
AA Change: N768K

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam29	C	T	8: 55,872,561	R286H	possibly damaging	Het
C87977	A	G	4: 144,208,811	V120A	probably damaging	Het
Cacfd1	T	G	2: 27,018,939	D97E	probably benign	Het
Ccnj	C	A	19: 40,832,085		probably null	Het
Chad	A	G	11: 94,565,624	Y176C	probably damaging	Het
Chd5	T	C	4: 152,356,676	L191P	probably damaging	Het
Cmtm1	T	C	8: 104,309,295	D190G	possibly damaging	Het
Cyp3a16	C	T	5: 145,440,431	A449T	probably damaging	Het
Eml5	T	C	12: 98,824,637	E1334G	probably benign	Het
Endou	C	T	15: 97,719,629	E147K	probably damaging	Het
Fbxo21	C	A	5: 118,000,356	H449N	probably benign	Het
Fkbp15	A	G	4: 62,332,270	I363T	probably damaging	Het
Gm12887	C	A	4: 121,615,637	G103C	probably damaging	Het
Gm14410	T	A	2: 177,193,508	H321L	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Irgm2	C	T	11: 58,220,052	P202S	probably benign	Het
Khsrp	G	A	17: 57,023,543	T551I	probably damaging	Het
Lpin2	T	A	17: 71,244,005	I720N	probably damaging	Het
Lypd8	G	A	11: 58,384,613	G58E	probably damaging	Het
Mdn1	G	T	4: 32,713,780	L1952F	probably damaging	Het
Med13	G	A	11: 86,298,954	P1043L	probably damaging	Het
Mycbp2	T	C	14: 103,142,881	T3832A	probably damaging	Het
Nrxn3	C	T	12: 89,513,049	R654C	probably damaging	Het
Olfr1082	T	C	2: 86,594,465	D121G	probably damaging	Het
Olfr512	T	C	7: 108,713,431	L14P	probably damaging	Het
Olfr530	G	T	7: 140,373,441	H56Q	possibly damaging	Het
Olfr535	A	G	7: 140,493,051	M138V	probably damaging	Het
Pcdhb6	A	G	18: 37,334,503	D159G	probably damaging	Het
Plec	T	C	15: 76,174,430	E3759G	probably damaging	Het
Plekho1	C	T	3: 95,989,321	D236N	probably damaging	Het
Pnma1	T	A	12: 84,147,423	I169F	probably benign	Het
Ppl	T	A	16: 5,087,616	H1605L	probably benign	Het
Ppp2r2b	T	A	18: 42,688,338	M252L	probably benign	Het
Prickle4	T	A	17: 47,689,333	R246*	probably null	Het
Rad50	G	A	11: 53,652,282	T1235I	probably damaging	Het
Ranbp10	T	C	8: 105,779,956	N244S	probably damaging	Het
Robo4	T	C	9: 37,404,368	S306P	possibly damaging	Het
Shox2	C	A	3: 66,981,285	R91L	probably benign	Het
Tbx5	A	G	5: 119,883,111	E394G	probably damaging	Het
Tcl1b5	A	G	12: 105,178,999	N74S	probably benign	Het
Tgif1	G	A	17: 70,846,560		probably benign	Het
Tmem128	T	A	5: 38,266,499		probably null	Het
Trio	A	G	15: 27,805,870	S511P	probably damaging	Het
Trps1	A	G	15: 50,822,427	I114T	probably benign	Het
Ttll8	G	T	15: 88,914,238	Q765K	probably benign	Het
Usp17ld	A	T	7: 103,250,755	D323E	probably damaging	Het
Vmn1r232	G	A	17: 20,914,047	T97I	probably benign	Het
Vmn2r28	T	A	7: 5,490,685	R87S	probably benign	Het
Vps26b	C	G	9: 27,010,466	E254D	probably benign	Het
Vps8	C	A	16: 21,554,125	Y113*	probably null	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Xcr1	A	T	9: 123,855,983	I238N	probably damaging	Het
Zar1l	T	A	5: 150,507,130	E272V	probably damaging	Het
Zfp451	A	G	1: 33,777,781	Y146H	probably damaging	Het
Zfp54	G	T	17: 21,433,474	E77*	probably null	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGGGAATAACAGGGACC -3'
(R):5'- GGTCTTCAAATTGCTGCATTCG -3'

Sequencing Primer
(F):5'- GGACCATCCCGGCAGTAAAG -3'
(R):5'- TCTCTGGCAAGTTGGAGTCCC -3'

Posted On

2018-06-06