Incidental Mutation 'R6555:Il1f6'
ID522055
Institutional Source Beutler Lab
Gene Symbol Il1f6
Ensembl Gene ENSMUSG00000026984
Gene Nameinterleukin 1 family, member 6
SynonymsFil1, IL-1H1, Fil1epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24215418-24225702 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 24224599 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028361]
Predicted Effect probably null
Transcript: ENSMUST00000028361
SMART Domains Protein: ENSMUSP00000028361
Gene: ENSMUSG00000026984

DomainStartEndE-ValueType
IL1 14 157 4.09e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144442
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that can activate NF-kappa-B and MAPK signaling pathways to generate an inflammatory response. The encoded protein functions primarily in skin and demonstrates increased expression in psoriasis. In addition, decreased expression of this gene has been linked to a poor prognosis in both hepatocellular carcinoma and colorectal cancer patients. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Il1f6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Il1f6 APN 2 24216580 missense probably benign 0.21
R1109:Il1f6 UTSW 2 24216590 missense probably damaging 1.00
R4657:Il1f6 UTSW 2 24224404 missense possibly damaging 0.54
R4879:Il1f6 UTSW 2 24216020 missense probably benign 0.06
R5213:Il1f6 UTSW 2 24224474 missense probably damaging 1.00
R7779:Il1f6 UTSW 2 24216601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAACCTGTAAAAGCCTCTCTC -3'
(R):5'- AGCTTTGCTACGCATCACC -3'

Sequencing Primer
(F):5'- TAAAAGCCTCTCTCTTCTATCACAAG -3'
(R):5'- CTTCCAAGTACCAGTTAACAGTTGGG -3'
Posted On2018-06-06