Incidental Mutation 'R6528:C87977'
ID 522056
Institutional Source Beutler Lab
Gene Symbol C87977
Ensembl Gene ENSMUSG00000046262
Gene Name expressed sequence C87977
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R6528 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 144206775-144213318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144208811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000101379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105753] [ENSMUST00000105754] [ENSMUST00000105755] [ENSMUST00000105757] [ENSMUST00000146836] [ENSMUST00000147855]
AlphaFold A2A958
Predicted Effect probably damaging
Transcript: ENSMUST00000105753
AA Change: V120A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000105754
AA Change: V120A

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000105755
SMART Domains Protein: ENSMUSP00000101381
Gene: ENSMUSG00000046262

DomainStartEndE-ValueType
SCOP:d1a4ya_ 52 250 9e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105757
AA Change: V120A

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101383
Gene: ENSMUSG00000046262
AA Change: V120A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132946
Predicted Effect possibly damaging
Transcript: ENSMUST00000146836
AA Change: V48A

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000147855
AA Change: V122A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in C87977
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:C87977 APN 4 144208475 missense possibly damaging 0.58
IGL02950:C87977 APN 4 144212961 missense probably benign 0.06
IGL03174:C87977 APN 4 144208430 missense probably benign
IGL03178:C87977 APN 4 144208251 critical splice donor site probably null
PIT4812001:C87977 UTSW 4 144209516 missense probably benign
R0622:C87977 UTSW 4 144213013 unclassified probably benign
R0634:C87977 UTSW 4 144209340 critical splice donor site probably null
R1127:C87977 UTSW 4 144207124 missense probably damaging 1.00
R1341:C87977 UTSW 4 144207559 missense probably damaging 1.00
R1697:C87977 UTSW 4 144208592 missense probably damaging 1.00
R1827:C87977 UTSW 4 144209610 missense probably damaging 0.99
R1857:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R2859:C87977 UTSW 4 144209622 missense probably benign 0.11
R4063:C87977 UTSW 4 144208695 missense possibly damaging 0.87
R4114:C87977 UTSW 4 144209603 missense probably damaging 1.00
R4130:C87977 UTSW 4 144208809 missense probably damaging 0.99
R4255:C87977 UTSW 4 144207484 missense possibly damaging 0.68
R4704:C87977 UTSW 4 144208592 missense probably damaging 1.00
R4840:C87977 UTSW 4 144208574 missense probably damaging 0.98
R5267:C87977 UTSW 4 144213005 unclassified probably benign
R5670:C87977 UTSW 4 144209622 missense probably benign 0.11
R6149:C87977 UTSW 4 144207413 missense probably damaging 0.98
R6508:C87977 UTSW 4 144207601 nonsense probably null
R7252:C87977 UTSW 4 144212940 missense possibly damaging 0.95
R7564:C87977 UTSW 4 144212955 missense probably damaging 1.00
R7704:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R8737:C87977 UTSW 4 144208622 missense probably damaging 1.00
Z1176:C87977 UTSW 4 144207461 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCACTGCAGCAAGTATGTGG -3'
(R):5'- GGCTAAAGATGCCCTCTTGC -3'

Sequencing Primer
(F):5'- CACTGCAGCAAGTATGTGGTAGATTC -3'
(R):5'- GATGCCCTCTTGCAAAGAATG -3'
Posted On 2018-06-06