Incidental Mutation 'R6528:Gtf2h3'
ID522064
Institutional Source Beutler Lab
Gene Symbol Gtf2h3
Ensembl Gene ENSMUSG00000029387
Gene Namegeneral transcription factor IIH, polypeptide 3
Synonyms34kDa, BTF2, D5Ertd679e, 5033417D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124579140-124597680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124584297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 121 (T121I)
Ref Sequence ENSEMBL: ENSMUSP00000031333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031333]
Predicted Effect probably benign
Transcript: ENSMUST00000031333
AA Change: T121I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031333
Gene: ENSMUSG00000029387
AA Change: T121I

DomainStartEndE-ValueType
Pfam:Tfb4 8 287 2.1e-108 PFAM
low complexity region 299 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200670
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Gtf2h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Gtf2h3 APN 5 124595668 missense probably damaging 0.96
IGL01611:Gtf2h3 APN 5 124595685 missense probably damaging 1.00
IGL01681:Gtf2h3 APN 5 124594791 missense probably damaging 1.00
IGL03097:Gtf2h3 UTSW 5 124602168 unclassified probably benign
R0599:Gtf2h3 UTSW 5 124588628 missense probably benign 0.00
R1512:Gtf2h3 UTSW 5 124590870 missense probably damaging 0.99
R1727:Gtf2h3 UTSW 5 124590356 missense probably benign 0.00
R1880:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1881:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1929:Gtf2h3 UTSW 5 124602199 unclassified probably benign
R2149:Gtf2h3 UTSW 5 124599785 unclassified probably benign
R2359:Gtf2h3 UTSW 5 124590876 missense probably damaging 1.00
R2993:Gtf2h3 UTSW 5 124583934 missense probably benign 0.00
R4399:Gtf2h3 UTSW 5 124602063 unclassified probably benign
R4551:Gtf2h3 UTSW 5 124590419 intron probably benign
R5282:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5289:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5566:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5567:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5569:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5570:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5581:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5583:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5709:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5784:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5967:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5968:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6036:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6050:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6518:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6519:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6520:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6526:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R7176:Gtf2h3 UTSW 5 124590370 missense probably damaging 0.99
R7184:Gtf2h3 UTSW 5 124584004 missense probably benign 0.22
Z1176:Gtf2h3 UTSW 5 124579175 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTCAGCCGGCTCTTATA -3'
(R):5'- ACAAAGCTGGGAGGCATGTA -3'

Sequencing Primer
(F):5'- CTCTTATACCCGGGGAAGAACG -3'
(R):5'- CTGGGAGGCATGTAGGGAG -3'
Posted On2018-06-06