Incidental Mutation 'R6555:Ctss'
ID522067
Institutional Source Beutler Lab
Gene Symbol Ctss
Ensembl Gene ENSMUSG00000038642
Gene Namecathepsin S
SynonymsCat S
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6555 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95526786-95556403 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 95543029 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 97 (L97*)
Ref Sequence ENSEMBL: ENSMUSP00000112006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015667] [ENSMUST00000116304]
PDB Structure
[]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)-1-(PHENYLSULFONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-1-[(2-CHLOROPHENYL)SULFONYL]-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000015667
AA Change: L98*
SMART Domains Protein: ENSMUSP00000015667
Gene: ENSMUSG00000038642
AA Change: L98*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Inhibitor_I29 39 99 2.3e-27 SMART
Pept_C1 126 342 2.3e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116304
AA Change: L97*
SMART Domains Protein: ENSMUSP00000112006
Gene: ENSMUSG00000038642
AA Change: L97*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 36 96 3.01e-23 SMART
Pept_C1 123 339 6.79e-120 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, which encode preproproteins that are proteolytically processed to generate mature protein products. This enzyme is secreted by antigen-presenting cells during inflammation and may induce pain and itch via activation of G-protein coupled receptors. Homozygous knockout mice for this gene exhibit impaired wound healing, reduced tumorigenesis in a pancreatic cancer model, and reduced pathogenesis in a myasthenia gravis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice are resistant to the development of experimental autoimmune myasthenia gravis and showed reduced T and B cell responses to acetylcholine receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Ctss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Ctss APN 3 95538725 missense probably damaging 1.00
IGL02162:Ctss APN 3 95546821 missense probably benign 0.26
IGL03026:Ctss APN 3 95538830 missense probably benign 0.01
IGL03219:Ctss APN 3 95543100 missense possibly damaging 0.88
clip UTSW 3 95545384 nonsense probably null
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0033:Ctss UTSW 3 95545577 splice site probably benign
R0033:Ctss UTSW 3 95545577 splice site probably benign
R1844:Ctss UTSW 3 95546794 critical splice acceptor site probably null
R2866:Ctss UTSW 3 95545406 missense probably benign 0.04
R4061:Ctss UTSW 3 95543034 missense probably benign 0.34
R4846:Ctss UTSW 3 95545384 nonsense probably null
R5917:Ctss UTSW 3 95543113 missense probably benign 0.00
R6443:Ctss UTSW 3 95546803 missense probably benign 0.00
R7391:Ctss UTSW 3 95529541 missense probably benign
R8007:Ctss UTSW 3 95550154 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAGTGGGTACAACTACCACTC -3'
(R):5'- TCCAGAGTGTGCAACGAGAC -3'

Sequencing Primer
(F):5'- GCGAACTGATTCCTGCAAGATGTTC -3'
(R):5'- CAGGGAGAGAGCACTCAGC -3'
Posted On2018-06-06