Incidental Mutation 'R6528:Vmn2r28'
ID522070
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Namevomeronasal 2, receptor 28
SynonymsEG665255
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location5479531-5493967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5490685 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 87 (R87S)
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
Predicted Effect probably benign
Transcript: ENSMUST00000086297
AA Change: R87S

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: R87S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5488069 missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5488184 missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5486478 missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5481088 missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5486464 missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5488162 missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5481303 missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5488124 missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5490569 missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5481004 missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5484016 missense probably damaging 0.98
R0288:Vmn2r28 UTSW 7 5488021 missense probably damaging 1.00
R0361:Vmn2r28 UTSW 7 5493716 missense probably benign 0.00
R0396:Vmn2r28 UTSW 7 5488514 missense probably benign 0.05
R0480:Vmn2r28 UTSW 7 5490457 missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5488690 missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R1282:Vmn2r28 UTSW 7 5481302 missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5481545 missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5493811 missense probably benign
R1853:Vmn2r28 UTSW 7 5481247 nonsense probably null
R1869:Vmn2r28 UTSW 7 5486346 missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5488289 missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5481071 missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5488314 missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5484131 missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5488702 missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5481392 missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5488358 missense probably damaging 1.00
R4307:Vmn2r28 UTSW 7 5490708 missense probably damaging 0.99
R5023:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5480672 missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5486377 missense probably damaging 0.99
R5472:Vmn2r28 UTSW 7 5487944 critical splice donor site probably null
R5511:Vmn2r28 UTSW 7 5484012 missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5488669 missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5493791 missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5488004 nonsense probably null
R6276:Vmn2r28 UTSW 7 5490731 missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5488475 missense probably benign 0.00
R6463:Vmn2r28 UTSW 7 5486436 missense probably benign 0.07
R6725:Vmn2r28 UTSW 7 5488409 missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5481230 missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5480807 missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5490734 missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5481496 missense probably benign 0.05
R7407:Vmn2r28 UTSW 7 5481309 missense probably damaging 1.00
R7563:Vmn2r28 UTSW 7 5488201 missense probably benign 0.00
R7611:Vmn2r28 UTSW 7 5481256 missense probably benign 0.02
R7808:Vmn2r28 UTSW 7 5493679 missense probably damaging 0.98
R7862:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
R7945:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTATGATAACTCACATGTGGAG -3'
(R):5'- TCAATCTTTAGAGGACAGAGGCAG -3'

Sequencing Primer
(F):5'- ATAAAGATGTGGTCATATCGGGTCC -3'
(R):5'- CAGAAGCATCCAGTACAGTATAGTGC -3'
Posted On2018-06-06