Incidental Mutation 'R6528:Olfr512'
ID522074
Institutional Source Beutler Lab
Gene Symbol Olfr512
Ensembl Gene ENSMUSG00000056946
Gene Nameolfactory receptor 512
SynonymsMOR268-3, GA_x6K02T2PBJ9-11043421-11044365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108713320-108714375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108713431 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 14 (L14P)
Ref Sequence ENSEMBL: ENSMUSP00000147972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074730] [ENSMUST00000209620]
Predicted Effect probably damaging
Transcript: ENSMUST00000074730
AA Change: L26P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074291
Gene: ENSMUSG00000056946
AA Change: L26P

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 7.8e-62 PFAM
Pfam:7TM_GPCR_Srsx 47 317 2.5e-6 PFAM
Pfam:7tm_1 53 302 2.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209620
AA Change: L14P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Olfr512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Olfr512 APN 7 108713882 missense probably benign 0.02
IGL01912:Olfr512 APN 7 108714258 missense possibly damaging 0.60
IGL02182:Olfr512 APN 7 108713868 missense probably benign 0.02
IGL02409:Olfr512 APN 7 108714159 missense probably benign 0.00
IGL02554:Olfr512 APN 7 108713742 missense possibly damaging 0.94
IGL03210:Olfr512 APN 7 108713568 missense probably damaging 1.00
IGL03373:Olfr512 APN 7 108714132 missense probably damaging 1.00
IGL03400:Olfr512 APN 7 108713526 missense probably benign 0.28
R0092:Olfr512 UTSW 7 108713824 missense probably benign
R0741:Olfr512 UTSW 7 108713604 missense probably benign 0.00
R1515:Olfr512 UTSW 7 108713941 missense possibly damaging 0.94
R1982:Olfr512 UTSW 7 108713695 missense probably damaging 1.00
R2176:Olfr512 UTSW 7 108714132 missense probably damaging 1.00
R3967:Olfr512 UTSW 7 108713853 missense probably benign
R4009:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4010:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4011:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R5095:Olfr512 UTSW 7 108713812 missense probably damaging 1.00
R5271:Olfr512 UTSW 7 108714217 missense probably damaging 1.00
R5864:Olfr512 UTSW 7 108713464 missense probably benign
R5926:Olfr512 UTSW 7 108713587 missense probably damaging 1.00
R6295:Olfr512 UTSW 7 108713638 missense probably damaging 0.98
R6624:Olfr512 UTSW 7 108713536 missense possibly damaging 0.50
R8029:Olfr512 UTSW 7 108713830 missense possibly damaging 0.70
X0023:Olfr512 UTSW 7 108714010 missense possibly damaging 0.79
Z1088:Olfr512 UTSW 7 108713538 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTCAAAACTGCTAATCTGAACCTC -3'
(R):5'- GTCAGGACCACAAGCATTTTAGG -3'

Sequencing Primer
(F):5'- GAACCTCTGTTAAAAAGAGCATGTC -3'
(R):5'- TGTGCTGAAACAGAGGTCTAC -3'
Posted On2018-06-06