Incidental Mutation 'R6555:Abcb1a'
ID 522075
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene Name ATP-binding cassette, sub-family B member 1A
Synonyms Evi32, multiple drug resistant 1a, Pgp, MDR3, Pgy-3, Mdr1a, P-glycoprotein, P-gp, Pgy3, mdr-3
MMRRC Submission 044680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R6555 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 8710077-8798575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8752468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 480 (I480V)
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
AlphaFold P21447
PDB Structure Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000047753
AA Change: I480V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584
AA Change: I480V

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap1 A T 11: 88,735,708 (GRCm39) I351N probably damaging Het
C1qtnf3 A G 15: 10,975,742 (GRCm39) M256V probably damaging Het
Carm1 T A 9: 21,498,258 (GRCm39) C421S probably damaging Het
Celsr2 T C 3: 108,302,235 (GRCm39) D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 (GRCm39) V319A probably damaging Het
Cntnap2 T A 6: 46,736,694 (GRCm39) W707R probably damaging Het
Ctss T A 3: 95,450,340 (GRCm39) L97* probably null Het
Eif2ak4 A T 2: 118,258,350 (GRCm39) N455Y probably damaging Het
Ercc6 G A 14: 32,239,064 (GRCm39) E51K probably benign Het
Gm10318 G A 10: 77,688,855 (GRCm39) probably benign Het
Gp6 C T 7: 4,387,929 (GRCm39) R180Q probably damaging Het
Gtsf1 T C 15: 103,333,902 (GRCm39) I25V probably damaging Het
Igkv1-99 A G 6: 68,519,300 (GRCm39) R85G probably damaging Het
Il36a G A 2: 24,114,611 (GRCm39) probably null Het
Iqsec3 T C 6: 121,361,178 (GRCm39) H935R probably damaging Het
Loxhd1 T C 18: 77,380,965 (GRCm39) V94A possibly damaging Het
Lrp2 T C 2: 69,339,647 (GRCm39) K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Lyst A G 13: 13,823,510 (GRCm39) N1494S probably benign Het
Mta3 C T 17: 84,015,875 (GRCm39) R26W probably damaging Het
Nup88 T C 11: 70,835,006 (GRCm39) R660G possibly damaging Het
Or1o1 G A 17: 37,716,796 (GRCm39) R119H probably benign Het
Or4q3 G A 14: 50,583,303 (GRCm39) Q168* probably null Het
Or5d16 T A 2: 87,773,632 (GRCm39) E113D probably damaging Het
Or8b51 C A 9: 38,569,585 (GRCm39) M34I probably benign Het
Pcdhga10 A G 18: 37,882,488 (GRCm39) T750A probably damaging Het
Plxnb1 A G 9: 108,937,473 (GRCm39) probably null Het
Ppip5k1 T C 2: 121,168,093 (GRCm39) E720G probably damaging Het
Pramel27 A G 4: 143,578,140 (GRCm39) I133M possibly damaging Het
Ptprn2 T C 12: 117,190,820 (GRCm39) Y786H probably damaging Het
Safb2 A G 17: 56,874,600 (GRCm39) V614A probably damaging Het
Safb2 A G 17: 56,889,982 (GRCm39) probably null Het
Selp C T 1: 163,969,171 (GRCm39) probably null Het
Slc16a10 T C 10: 39,956,774 (GRCm39) I122V probably benign Het
Slc22a22 G A 15: 57,122,527 (GRCm39) T131M probably benign Het
Trmt2a A T 16: 18,071,067 (GRCm39) I574F probably benign Het
Tsen54 C T 11: 115,711,519 (GRCm39) T156I probably benign Het
Vps13b A G 15: 35,846,993 (GRCm39) N2592S probably damaging Het
Wdr64 G A 1: 175,547,856 (GRCm39) R131H probably damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8,736,257 (GRCm39) missense probably benign 0.01
IGL00898:Abcb1a APN 5 8,783,690 (GRCm39) missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8,782,388 (GRCm39) missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8,724,687 (GRCm39) missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8,752,550 (GRCm39) missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8,748,637 (GRCm39) missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8,765,065 (GRCm39) critical splice donor site probably null
IGL01820:Abcb1a APN 5 8,765,896 (GRCm39) splice site probably benign
IGL02499:Abcb1a APN 5 8,776,807 (GRCm39) missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8,773,245 (GRCm39) splice site probably null
IGL02954:Abcb1a APN 5 8,782,341 (GRCm39) missense probably benign 0.00
IGL03018:Abcb1a APN 5 8,752,451 (GRCm39) missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8,764,887 (GRCm39) missense probably benign 0.00
IGL03292:Abcb1a APN 5 8,765,827 (GRCm39) missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8,744,153 (GRCm39) missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8,763,281 (GRCm39) missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8,748,535 (GRCm39) missense probably benign 0.01
R0595:Abcb1a UTSW 5 8,790,417 (GRCm39) missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8,748,539 (GRCm39) missense probably benign 0.13
R0811:Abcb1a UTSW 5 8,763,229 (GRCm39) missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8,763,229 (GRCm39) missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8,724,856 (GRCm39) splice site probably benign
R0948:Abcb1a UTSW 5 8,790,621 (GRCm39) splice site probably null
R1292:Abcb1a UTSW 5 8,763,343 (GRCm39) missense probably benign 0.00
R1318:Abcb1a UTSW 5 8,751,621 (GRCm39) missense probably benign 0.31
R1459:Abcb1a UTSW 5 8,752,920 (GRCm39) missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8,736,300 (GRCm39) critical splice donor site probably null
R1514:Abcb1a UTSW 5 8,724,791 (GRCm39) missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8,763,202 (GRCm39) missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8,788,747 (GRCm39) missense probably benign 0.30
R2844:Abcb1a UTSW 5 8,736,164 (GRCm39) missense probably benign 0.02
R3709:Abcb1a UTSW 5 8,788,738 (GRCm39) missense probably benign 0.03
R3755:Abcb1a UTSW 5 8,797,403 (GRCm39) missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8,765,068 (GRCm39) splice site probably null
R4401:Abcb1a UTSW 5 8,752,390 (GRCm39) missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8,769,981 (GRCm39) splice site probably benign
R4539:Abcb1a UTSW 5 8,765,793 (GRCm39) missense probably benign
R4635:Abcb1a UTSW 5 8,764,927 (GRCm39) missense probably benign
R4740:Abcb1a UTSW 5 8,752,280 (GRCm39) critical splice donor site probably null
R4757:Abcb1a UTSW 5 8,787,632 (GRCm39) missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8,765,732 (GRCm39) splice site probably null
R4792:Abcb1a UTSW 5 8,796,657 (GRCm39) critical splice donor site probably null
R4829:Abcb1a UTSW 5 8,773,214 (GRCm39) missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8,787,773 (GRCm39) critical splice donor site probably null
R5140:Abcb1a UTSW 5 8,752,154 (GRCm39) missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8,764,937 (GRCm39) missense probably benign
R5355:Abcb1a UTSW 5 8,776,873 (GRCm39) missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8,752,946 (GRCm39) missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8,724,818 (GRCm39) missense probably benign
R5557:Abcb1a UTSW 5 8,764,949 (GRCm39) missense probably benign 0.01
R5572:Abcb1a UTSW 5 8,765,108 (GRCm39) splice site probably null
R5702:Abcb1a UTSW 5 8,787,752 (GRCm39) missense probably benign 0.15
R5753:Abcb1a UTSW 5 8,773,160 (GRCm39) missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8,733,426 (GRCm39) missense probably benign 0.01
R5895:Abcb1a UTSW 5 8,752,216 (GRCm39) missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8,769,030 (GRCm39) missense probably benign 0.01
R6798:Abcb1a UTSW 5 8,782,364 (GRCm39) missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8,751,628 (GRCm39) missense probably benign 0.28
R7000:Abcb1a UTSW 5 8,752,823 (GRCm39) missense probably benign 0.19
R7102:Abcb1a UTSW 5 8,744,072 (GRCm39) missense probably benign 0.01
R7172:Abcb1a UTSW 5 8,752,399 (GRCm39) missense probably benign 0.00
R7313:Abcb1a UTSW 5 8,773,187 (GRCm39) missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8,765,771 (GRCm39) nonsense probably null
R7718:Abcb1a UTSW 5 8,765,788 (GRCm39) missense probably damaging 1.00
R7816:Abcb1a UTSW 5 8,736,132 (GRCm39) missense possibly damaging 0.56
R7829:Abcb1a UTSW 5 8,748,623 (GRCm39) missense probably benign 0.06
R7943:Abcb1a UTSW 5 8,736,222 (GRCm39) missense probably benign
R8040:Abcb1a UTSW 5 8,765,035 (GRCm39) missense probably benign 0.00
R8086:Abcb1a UTSW 5 8,724,833 (GRCm39) missense probably benign
R8271:Abcb1a UTSW 5 8,736,212 (GRCm39) missense probably benign 0.41
R8367:Abcb1a UTSW 5 8,736,221 (GRCm39) missense probably benign 0.00
R8520:Abcb1a UTSW 5 8,735,346 (GRCm39) missense possibly damaging 0.67
R8680:Abcb1a UTSW 5 8,735,371 (GRCm39) missense probably damaging 0.99
R8820:Abcb1a UTSW 5 8,773,204 (GRCm39) missense possibly damaging 0.69
R8996:Abcb1a UTSW 5 8,769,069 (GRCm39) missense probably benign 0.00
R9114:Abcb1a UTSW 5 8,788,702 (GRCm39) nonsense probably null
R9127:Abcb1a UTSW 5 8,724,707 (GRCm39) missense probably benign
R9187:Abcb1a UTSW 5 8,765,016 (GRCm39) missense probably benign
R9294:Abcb1a UTSW 5 8,736,171 (GRCm39) missense probably benign 0.02
R9459:Abcb1a UTSW 5 8,735,414 (GRCm39) critical splice donor site probably null
R9581:Abcb1a UTSW 5 8,790,428 (GRCm39) missense possibly damaging 0.66
R9617:Abcb1a UTSW 5 8,797,353 (GRCm39) critical splice acceptor site probably null
R9676:Abcb1a UTSW 5 8,714,548 (GRCm39) missense possibly damaging 0.87
R9682:Abcb1a UTSW 5 8,752,507 (GRCm39) missense probably benign 0.44
R9790:Abcb1a UTSW 5 8,748,604 (GRCm39) missense probably damaging 1.00
R9791:Abcb1a UTSW 5 8,748,604 (GRCm39) missense probably damaging 1.00
Z1177:Abcb1a UTSW 5 8,796,544 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGCTGATGCAAAGGCTC -3'
(R):5'- ATGAACCGCATTAATCAGAGCTC -3'

Sequencing Primer
(F):5'- GCTGATGCAAAGGCTCTACGAC -3'
(R):5'- CCGCATTAATCAGAGCTCTACTC -3'
Posted On 2018-06-06