Mutagenetix > Incidental Mutation

Incidental Mutation 'R6555:Cntnap2'

522077

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

Caspr2, 5430425M22Rik

MMRRC Submission

044680-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6555 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45036995-47278330 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46736694 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 707 (W707R)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000114641
AA Change: W707R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: W707R

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Meta Mutation Damage Score

0.8434

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	G	5: 8,752,468 (GRCm39)	I480V	probably damaging	Het
Akap1	A	T	11: 88,735,708 (GRCm39)	I351N	probably damaging	Het
C1qtnf3	A	G	15: 10,975,742 (GRCm39)	M256V	probably damaging	Het
Carm1	T	A	9: 21,498,258 (GRCm39)	C421S	probably damaging	Het
Celsr2	T	C	3: 108,302,235 (GRCm39)	D2631G	probably damaging	Het
Cfap206	A	G	4: 34,719,049 (GRCm39)	V319A	probably damaging	Het
Ctss	T	A	3: 95,450,340 (GRCm39)	L97*	probably null	Het
Eif2ak4	A	T	2: 118,258,350 (GRCm39)	N455Y	probably damaging	Het
Ercc6	G	A	14: 32,239,064 (GRCm39)	E51K	probably benign	Het
Gm10318	G	A	10: 77,688,855 (GRCm39)		probably benign	Het
Gp6	C	T	7: 4,387,929 (GRCm39)	R180Q	probably damaging	Het
Gtsf1	T	C	15: 103,333,902 (GRCm39)	I25V	probably damaging	Het
Igkv1-99	A	G	6: 68,519,300 (GRCm39)	R85G	probably damaging	Het
Il36a	G	A	2: 24,114,611 (GRCm39)		probably null	Het
Iqsec3	T	C	6: 121,361,178 (GRCm39)	H935R	probably damaging	Het
Loxhd1	T	C	18: 77,380,965 (GRCm39)	V94A	possibly damaging	Het
Lrp2	T	C	2: 69,339,647 (GRCm39)	K1088R	probably benign	Het
Lsm3	GATATATA	GATATATATA	6: 91,496,617 (GRCm39)		probably null	Het
Lyst	A	G	13: 13,823,510 (GRCm39)	N1494S	probably benign	Het
Mta3	C	T	17: 84,015,875 (GRCm39)	R26W	probably damaging	Het
Nup88	T	C	11: 70,835,006 (GRCm39)	R660G	possibly damaging	Het
Or1o1	G	A	17: 37,716,796 (GRCm39)	R119H	probably benign	Het
Or4q3	G	A	14: 50,583,303 (GRCm39)	Q168*	probably null	Het
Or5d16	T	A	2: 87,773,632 (GRCm39)	E113D	probably damaging	Het
Or8b51	C	A	9: 38,569,585 (GRCm39)	M34I	probably benign	Het
Pcdhga10	A	G	18: 37,882,488 (GRCm39)	T750A	probably damaging	Het
Plxnb1	A	G	9: 108,937,473 (GRCm39)		probably null	Het
Ppip5k1	T	C	2: 121,168,093 (GRCm39)	E720G	probably damaging	Het
Pramel27	A	G	4: 143,578,140 (GRCm39)	I133M	possibly damaging	Het
Ptprn2	T	C	12: 117,190,820 (GRCm39)	Y786H	probably damaging	Het
Safb2	A	G	17: 56,874,600 (GRCm39)	V614A	probably damaging	Het
Safb2	A	G	17: 56,889,982 (GRCm39)		probably null	Het
Selp	C	T	1: 163,969,171 (GRCm39)		probably null	Het
Slc16a10	T	C	10: 39,956,774 (GRCm39)	I122V	probably benign	Het
Slc22a22	G	A	15: 57,122,527 (GRCm39)	T131M	probably benign	Het
Trmt2a	A	T	16: 18,071,067 (GRCm39)	I574F	probably benign	Het
Tsen54	C	T	11: 115,711,519 (GRCm39)	T156I	probably benign	Het
Vps13b	A	G	15: 35,846,993 (GRCm39)	N2592S	probably damaging	Het
Wdr64	G	A	1: 175,547,856 (GRCm39)	R131H	probably damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	45,992,197 (GRCm39)	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46,965,721 (GRCm39)	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47,169,972 (GRCm39)	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46,461,006 (GRCm39)	missense	probably benign
IGL00857:Cntnap2	APN	6	47,026,358 (GRCm39)	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	45,992,399 (GRCm39)	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47,169,947 (GRCm39)	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47,248,305 (GRCm39)	nonsense	probably null
IGL01859:Cntnap2	APN	6	46,965,655 (GRCm39)	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46,211,137 (GRCm39)	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	46,998,588 (GRCm39)	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46,211,254 (GRCm39)	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	46,998,670 (GRCm39)	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46,147,179 (GRCm39)	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46,507,105 (GRCm39)	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46,460,917 (GRCm39)	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45,037,326 (GRCm39)	splice site	probably null
R0352:Cntnap2	UTSW	6	45,969,018 (GRCm39)	splice site	probably null
R0389:Cntnap2	UTSW	6	45,986,571 (GRCm39)	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45,692,750 (GRCm39)	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46,506,839 (GRCm39)	nonsense	probably null
R0611:Cntnap2	UTSW	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46,965,694 (GRCm39)	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47,273,642 (GRCm39)	splice site	probably benign
R0976:Cntnap2	UTSW	6	47,248,164 (GRCm39)	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1387:Cntnap2	UTSW	6	47,084,848 (GRCm39)	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46,507,613 (GRCm39)	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	45,992,264 (GRCm39)	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47,084,826 (GRCm39)	nonsense	probably null
R1757:Cntnap2	UTSW	6	46,736,763 (GRCm39)	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46,965,609 (GRCm39)	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46,507,567 (GRCm39)	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47,275,522 (GRCm39)	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47,275,379 (GRCm39)	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	45,992,200 (GRCm39)	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45,968,837 (GRCm39)	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4030:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4237:Cntnap2	UTSW	6	46,507,324 (GRCm39)	intron	probably benign
R4445:Cntnap2	UTSW	6	46,736,785 (GRCm39)	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4918:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4999:Cntnap2	UTSW	6	45,897,768 (GRCm39)	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45,897,860 (GRCm39)	nonsense	probably null
R5748:Cntnap2	UTSW	6	45,692,818 (GRCm39)	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46,506,749 (GRCm39)	intron	probably benign
R6118:Cntnap2	UTSW	6	47,170,011 (GRCm39)	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46,736,742 (GRCm39)	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47,248,232 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45,037,046 (GRCm39)	splice site	probably null
R6385:Cntnap2	UTSW	6	46,833,114 (GRCm39)	missense	probably benign	0.00
R6577:Cntnap2	UTSW	6	46,147,206 (GRCm39)	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	45,992,191 (GRCm39)	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46,965,580 (GRCm39)	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47,248,205 (GRCm39)	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46,460,963 (GRCm39)	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46,324,079 (GRCm39)	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47,072,627 (GRCm39)	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46,736,707 (GRCm39)	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45,968,975 (GRCm39)	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47,026,156 (GRCm39)	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	45,978,161 (GRCm39)	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46,833,076 (GRCm39)	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46,460,983 (GRCm39)	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46,461,139 (GRCm39)	intron	probably benign
R9209:Cntnap2	UTSW	6	47,026,183 (GRCm39)	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	45,978,112 (GRCm39)	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	45,978,281 (GRCm39)	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	45,978,244 (GRCm39)	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46,211,217 (GRCm39)	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	45,992,165 (GRCm39)	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45,969,009 (GRCm39)	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46,965,726 (GRCm39)	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	45,992,373 (GRCm39)	frame shift	probably null
R9745:Cntnap2	UTSW	6	46,211,100 (GRCm39)	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47,026,261 (GRCm39)	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	46,998,599 (GRCm39)	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	45,986,452 (GRCm39)	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	46,998,688 (GRCm39)	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46,211,179 (GRCm39)	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47,248,082 (GRCm39)	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	45,992,233 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACCATTTAGGATTCCAGCTCAC -3'
(R):5'- AATCCATTTGACCTGCAGATTC -3'

Sequencing Primer
(F):5'- GAAACTGCTATAGCTCCTAGG -3'
(R):5'- CAGATTCAGGGAGGCTGTGCTC -3'

Posted On

2018-06-06