Incidental Mutation 'R6528:Adam29'
ID522080
Institutional Source Beutler Lab
Gene Symbol Adam29
Ensembl Gene ENSMUSG00000046258
Gene Namea disintegrin and metallopeptidase domain 29
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_175939; MGI: 2676326

Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location55870912-55906948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55872561 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 286 (R286H)
Ref Sequence ENSEMBL: ENSMUSP00000054292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053441
AA Change: R286H

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054292
Gene: ENSMUSG00000046258
AA Change: R286H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 159 1.9e-17 PFAM
Pfam:Reprolysin_4 203 394 3.3e-10 PFAM
Pfam:Reprolysin_5 203 403 6.9e-15 PFAM
Pfam:Reprolysin 205 395 1.5e-48 PFAM
Pfam:Reprolysin_2 226 386 7.4e-11 PFAM
Pfam:Reprolysin_3 228 349 1.4e-11 PFAM
DISIN 412 487 4.26e-37 SMART
ACR 488 624 2.85e-58 SMART
low complexity region 642 651 N/A INTRINSIC
transmembrane domain 683 705 N/A INTRINSIC
low complexity region 713 746 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Adam29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Adam29 APN 8 55871844 missense probably benign 0.01
IGL01406:Adam29 APN 8 55871839 missense probably damaging 1.00
IGL01511:Adam29 APN 8 55871421 missense probably damaging 1.00
IGL01869:Adam29 APN 8 55871697 missense probably damaging 0.99
IGL01894:Adam29 APN 8 55871830 missense probably benign 0.00
IGL02023:Adam29 APN 8 55872484 missense probably benign 0.12
IGL02030:Adam29 APN 8 55872122 missense probably benign 0.35
IGL02071:Adam29 APN 8 55871554 missense possibly damaging 0.95
IGL02094:Adam29 APN 8 55871445 missense possibly damaging 0.48
IGL02108:Adam29 APN 8 55872311 missense probably damaging 0.98
IGL02125:Adam29 APN 8 55871939 nonsense probably null
IGL02330:Adam29 APN 8 55872363 missense probably benign 0.02
IGL02332:Adam29 APN 8 55871740 missense probably damaging 1.00
IGL02548:Adam29 APN 8 55872867 nonsense probably null
IGL02960:Adam29 APN 8 55872666 nonsense probably null
IGL03030:Adam29 APN 8 55873065 missense probably damaging 1.00
ANU22:Adam29 UTSW 8 55871844 missense probably benign 0.01
D4043:Adam29 UTSW 8 55872461 nonsense probably null
IGL02835:Adam29 UTSW 8 55873138 missense probably damaging 1.00
R0294:Adam29 UTSW 8 55873276 missense probably benign 0.25
R0449:Adam29 UTSW 8 55872681 missense probably benign 0.01
R0607:Adam29 UTSW 8 55873275 missense probably damaging 1.00
R0626:Adam29 UTSW 8 55871577 missense probably benign 0.24
R1296:Adam29 UTSW 8 55871719 nonsense probably null
R1752:Adam29 UTSW 8 55872274 missense probably damaging 0.98
R1930:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R1931:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R2397:Adam29 UTSW 8 55872898 missense probably benign 0.04
R2764:Adam29 UTSW 8 55871756 missense probably damaging 1.00
R4052:Adam29 UTSW 8 55872282 missense probably damaging 1.00
R4978:Adam29 UTSW 8 55871401 missense probably damaging 0.98
R5306:Adam29 UTSW 8 55871757 missense probably damaging 1.00
R6383:Adam29 UTSW 8 55871508 missense probably damaging 0.99
R6579:Adam29 UTSW 8 55872744 missense probably damaging 1.00
R6707:Adam29 UTSW 8 55872100 missense probably damaging 1.00
R7076:Adam29 UTSW 8 55871659 missense probably damaging 1.00
R7099:Adam29 UTSW 8 55871404 missense probably benign 0.01
R7177:Adam29 UTSW 8 55872624 missense probably benign 0.30
R7320:Adam29 UTSW 8 55872714 missense possibly damaging 0.50
R7420:Adam29 UTSW 8 55872898 missense probably benign 0.04
R7438:Adam29 UTSW 8 55871574 missense probably damaging 0.99
R7476:Adam29 UTSW 8 55873195 missense probably damaging 0.97
R7524:Adam29 UTSW 8 55872360 missense probably damaging 1.00
R8066:Adam29 UTSW 8 55872668 missense probably benign 0.11
R8111:Adam29 UTSW 8 55871550 missense probably benign 0.00
R8221:Adam29 UTSW 8 55872428 missense probably benign 0.02
X0011:Adam29 UTSW 8 55873168 missense probably benign 0.02
Z1177:Adam29 UTSW 8 55871496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTCCATGTGCATTATAC -3'
(R):5'- AATGCTGTCAGATCTGTATTCTGTG -3'

Sequencing Primer
(F):5'- CATGCCCAAATTATGACCTAAGTG -3'
(R):5'- GTGGATACCATTTATGAGGT -3'
Posted On2018-06-06