Incidental Mutation 'R6555:Iqsec3'
ID522083
Institutional Source Beutler Lab
Gene Symbol Iqsec3
Ensembl Gene ENSMUSG00000040797
Gene NameIQ motif and Sec7 domain 3
SynonymssynarfGEF, BRAG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location121372933-121473678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121384219 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 935 (H935R)
Ref Sequence ENSEMBL: ENSMUSP00000038653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046373] [ENSMUST00000129815] [ENSMUST00000152103]
Predicted Effect probably damaging
Transcript: ENSMUST00000046373
AA Change: H935R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038653
Gene: ENSMUSG00000040797
AA Change: H935R

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Blast:Sec7 285 354 5e-16 BLAST
low complexity region 367 386 N/A INTRINSIC
Blast:Sec7 476 507 2e-9 BLAST
low complexity region 508 531 N/A INTRINSIC
low complexity region 542 594 N/A INTRINSIC
low complexity region 598 628 N/A INTRINSIC
Sec7 652 843 9.53e-89 SMART
PH 874 985 4.03e0 SMART
low complexity region 1065 1105 N/A INTRINSIC
low complexity region 1126 1144 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
low complexity region 1182 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129815
SMART Domains Protein: ENSMUSP00000120847
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152103
SMART Domains Protein: ENSMUSP00000116317
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Iqsec3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Iqsec3 APN 6 121473124 missense possibly damaging 0.90
IGL01615:Iqsec3 APN 6 121410621 missense probably damaging 1.00
IGL01728:Iqsec3 APN 6 121412664 utr 3 prime probably benign
IGL01935:Iqsec3 APN 6 121383992 missense probably damaging 1.00
IGL02146:Iqsec3 APN 6 121383957 missense probably damaging 0.99
IGL02369:Iqsec3 APN 6 121412934 utr 3 prime probably benign
IGL02684:Iqsec3 APN 6 121412941 nonsense probably null
IGL03180:Iqsec3 APN 6 121413508 utr 3 prime probably benign
R0032:Iqsec3 UTSW 6 121473130 missense possibly damaging 0.71
R0088:Iqsec3 UTSW 6 121473289 missense probably damaging 0.97
R0189:Iqsec3 UTSW 6 121413562 utr 3 prime probably benign
R0193:Iqsec3 UTSW 6 121410724 missense probably damaging 1.00
R0528:Iqsec3 UTSW 6 121412784 utr 3 prime probably benign
R1885:Iqsec3 UTSW 6 121428367 intron probably benign
R2698:Iqsec3 UTSW 6 121413471 utr 3 prime probably benign
R3751:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3753:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3947:Iqsec3 UTSW 6 121387824 nonsense probably null
R3948:Iqsec3 UTSW 6 121387824 nonsense probably null
R3949:Iqsec3 UTSW 6 121387824 nonsense probably null
R4006:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4007:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4210:Iqsec3 UTSW 6 121413040 utr 3 prime probably benign
R4535:Iqsec3 UTSW 6 121380018 missense possibly damaging 0.80
R4567:Iqsec3 UTSW 6 121387762 missense probably damaging 1.00
R5096:Iqsec3 UTSW 6 121386698 missense probably damaging 1.00
R5135:Iqsec3 UTSW 6 121383919 missense probably damaging 1.00
R5289:Iqsec3 UTSW 6 121386700 critical splice acceptor site probably null
R5537:Iqsec3 UTSW 6 121412644 utr 3 prime probably benign
R6942:Iqsec3 UTSW 6 121473103 missense probably damaging 1.00
R7122:Iqsec3 UTSW 6 121473358 missense unknown
R7372:Iqsec3 UTSW 6 121384032 nonsense probably null
R7394:Iqsec3 UTSW 6 121386610 missense possibly damaging 0.47
R7559:Iqsec3 UTSW 6 121387780 missense probably damaging 1.00
R7729:Iqsec3 UTSW 6 121383981 missense probably damaging 1.00
R7815:Iqsec3 UTSW 6 121473358 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCACGAACTTCTGCATCTCG -3'
(R):5'- ACATTCACGACGTCTCTGG -3'

Sequencing Primer
(F):5'- GAACTTCTGCATCTCGTCGGAG -3'
(R):5'- ACGACGTCTCTGGGCGTC -3'
Posted On2018-06-06