Incidental Mutation 'R6555:Gp6'
ID522084
Institutional Source Beutler Lab
Gene Symbol Gp6
Ensembl Gene ENSMUSG00000078810
Gene Nameglycoprotein 6 (platelet)
SynonymsGpvi, 9830166G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4363965-4397744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4384930 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 180 (R180Q)
Ref Sequence ENSEMBL: ENSMUSP00000145740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108590] [ENSMUST00000206928]
Predicted Effect probably damaging
Transcript: ENSMUST00000108590
AA Change: R180Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104231
Gene: ENSMUSG00000078810
AA Change: R180Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 34 109 7.47e-3 SMART
IG 120 204 9.86e-3 SMART
transmembrane domain 266 285 N/A INTRINSIC
low complexity region 306 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177728
Predicted Effect probably damaging
Transcript: ENSMUST00000206928
AA Change: R180Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous with disruptions in this gene display functional abnormalities in their platelets including failure of the platelets to aggregate and to become activated. The effects on blood clotting are minor however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Gp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Gp6 APN 7 4394104 splice site probably benign
IGL02351:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02358:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02660:Gp6 APN 7 4384998 missense probably benign 0.01
IGL03081:Gp6 APN 7 4371648 missense probably benign 0.01
R0112:Gp6 UTSW 7 4370184 missense probably benign 0.08
R0112:Gp6 UTSW 7 4371627 missense probably benign 0.12
R0211:Gp6 UTSW 7 4373209 critical splice donor site probably null
R0356:Gp6 UTSW 7 4370142 splice site probably benign
R2006:Gp6 UTSW 7 4384989 missense probably benign 0.33
R2047:Gp6 UTSW 7 4373271 splice site probably benign
R5219:Gp6 UTSW 7 4368999 missense possibly damaging 0.70
R5571:Gp6 UTSW 7 4368900 missense probably damaging 1.00
R5639:Gp6 UTSW 7 4394131 missense probably damaging 1.00
R6224:Gp6 UTSW 7 4394212 missense probably benign 0.03
R7625:Gp6 UTSW 7 4370174 missense probably benign 0.37
R8113:Gp6 UTSW 7 4394115 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGATTGGAGCCAGAGGATCTC -3'
(R):5'- ATAGAGTTTTCTTTCTTCCCAGGTG -3'

Sequencing Primer
(F):5'- AGGATCTCCTTGCCCACAC -3'
(R):5'- AGGTGTGTATGCTAAACCCTCAC -3'
Posted On2018-06-06