Incidental Mutation 'R6555:Plxnb1'
ID 522090
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Name plexin B1
Synonyms 2900002G15Rik
MMRRC Submission 044680-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6555 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108924457-108948985 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 108937473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000072093]
AlphaFold Q8CJH3
Predicted Effect probably null
Transcript: ENSMUST00000072093
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072093
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192117
Predicted Effect probably null
Transcript: ENSMUST00000192988
Predicted Effect probably null
Transcript: ENSMUST00000192988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195364
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,752,468 (GRCm39) I480V probably damaging Het
Akap1 A T 11: 88,735,708 (GRCm39) I351N probably damaging Het
C1qtnf3 A G 15: 10,975,742 (GRCm39) M256V probably damaging Het
Carm1 T A 9: 21,498,258 (GRCm39) C421S probably damaging Het
Celsr2 T C 3: 108,302,235 (GRCm39) D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 (GRCm39) V319A probably damaging Het
Cntnap2 T A 6: 46,736,694 (GRCm39) W707R probably damaging Het
Ctss T A 3: 95,450,340 (GRCm39) L97* probably null Het
Eif2ak4 A T 2: 118,258,350 (GRCm39) N455Y probably damaging Het
Ercc6 G A 14: 32,239,064 (GRCm39) E51K probably benign Het
Gm10318 G A 10: 77,688,855 (GRCm39) probably benign Het
Gp6 C T 7: 4,387,929 (GRCm39) R180Q probably damaging Het
Gtsf1 T C 15: 103,333,902 (GRCm39) I25V probably damaging Het
Igkv1-99 A G 6: 68,519,300 (GRCm39) R85G probably damaging Het
Il36a G A 2: 24,114,611 (GRCm39) probably null Het
Iqsec3 T C 6: 121,361,178 (GRCm39) H935R probably damaging Het
Loxhd1 T C 18: 77,380,965 (GRCm39) V94A possibly damaging Het
Lrp2 T C 2: 69,339,647 (GRCm39) K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Lyst A G 13: 13,823,510 (GRCm39) N1494S probably benign Het
Mta3 C T 17: 84,015,875 (GRCm39) R26W probably damaging Het
Nup88 T C 11: 70,835,006 (GRCm39) R660G possibly damaging Het
Or1o1 G A 17: 37,716,796 (GRCm39) R119H probably benign Het
Or4q3 G A 14: 50,583,303 (GRCm39) Q168* probably null Het
Or5d16 T A 2: 87,773,632 (GRCm39) E113D probably damaging Het
Or8b51 C A 9: 38,569,585 (GRCm39) M34I probably benign Het
Pcdhga10 A G 18: 37,882,488 (GRCm39) T750A probably damaging Het
Ppip5k1 T C 2: 121,168,093 (GRCm39) E720G probably damaging Het
Pramel27 A G 4: 143,578,140 (GRCm39) I133M possibly damaging Het
Ptprn2 T C 12: 117,190,820 (GRCm39) Y786H probably damaging Het
Safb2 A G 17: 56,874,600 (GRCm39) V614A probably damaging Het
Safb2 A G 17: 56,889,982 (GRCm39) probably null Het
Selp C T 1: 163,969,171 (GRCm39) probably null Het
Slc16a10 T C 10: 39,956,774 (GRCm39) I122V probably benign Het
Slc22a22 G A 15: 57,122,527 (GRCm39) T131M probably benign Het
Trmt2a A T 16: 18,071,067 (GRCm39) I574F probably benign Het
Tsen54 C T 11: 115,711,519 (GRCm39) T156I probably benign Het
Vps13b A G 15: 35,846,993 (GRCm39) N2592S probably damaging Het
Wdr64 G A 1: 175,547,856 (GRCm39) R131H probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 108,942,936 (GRCm39) missense probably benign 0.04
IGL01014:Plxnb1 APN 9 108,935,102 (GRCm39) missense probably benign 0.00
IGL01142:Plxnb1 APN 9 108,931,765 (GRCm39) missense probably benign 0.05
IGL01454:Plxnb1 APN 9 108,942,422 (GRCm39) missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 108,934,483 (GRCm39) intron probably benign
IGL01530:Plxnb1 APN 9 108,939,473 (GRCm39) missense probably benign 0.02
IGL01599:Plxnb1 APN 9 108,939,672 (GRCm39) missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 108,930,052 (GRCm39) missense probably benign 0.00
IGL02175:Plxnb1 APN 9 108,929,914 (GRCm39) missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 108,929,918 (GRCm39) missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 108,941,201 (GRCm39) missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 108,930,190 (GRCm39) missense probably benign
IGL02645:Plxnb1 APN 9 108,943,311 (GRCm39) splice site probably benign
IGL03076:Plxnb1 APN 9 108,935,970 (GRCm39) missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 108,934,054 (GRCm39) missense probably benign
IGL03343:Plxnb1 APN 9 108,943,780 (GRCm39) missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 108,929,786 (GRCm39) missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 108,934,286 (GRCm39) missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 108,932,731 (GRCm39) nonsense probably null
R0211:Plxnb1 UTSW 9 108,932,731 (GRCm39) nonsense probably null
R0843:Plxnb1 UTSW 9 108,942,769 (GRCm39) missense probably benign 0.20
R0970:Plxnb1 UTSW 9 108,932,331 (GRCm39) missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 108,931,210 (GRCm39) missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 108,929,720 (GRCm39) missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 108,930,091 (GRCm39) missense probably benign 0.27
R1419:Plxnb1 UTSW 9 108,943,454 (GRCm39) missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 108,937,989 (GRCm39) missense probably null
R1548:Plxnb1 UTSW 9 108,929,968 (GRCm39) missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 108,935,873 (GRCm39) missense probably benign 0.04
R1658:Plxnb1 UTSW 9 108,931,939 (GRCm39) nonsense probably null
R1727:Plxnb1 UTSW 9 108,930,125 (GRCm39) splice site probably null
R1750:Plxnb1 UTSW 9 108,940,836 (GRCm39) missense probably benign 0.00
R1795:Plxnb1 UTSW 9 108,929,813 (GRCm39) missense probably benign
R1929:Plxnb1 UTSW 9 108,931,776 (GRCm39) splice site probably null
R1935:Plxnb1 UTSW 9 108,924,715 (GRCm39) critical splice donor site probably null
R1936:Plxnb1 UTSW 9 108,924,715 (GRCm39) critical splice donor site probably null
R2014:Plxnb1 UTSW 9 108,935,687 (GRCm39) splice site probably benign
R2057:Plxnb1 UTSW 9 108,938,294 (GRCm39) missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 108,944,810 (GRCm39) missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 108,931,776 (GRCm39) splice site probably null
R2422:Plxnb1 UTSW 9 108,937,506 (GRCm39) missense probably benign 0.02
R2881:Plxnb1 UTSW 9 108,943,480 (GRCm39) missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 108,935,681 (GRCm39) splice site probably null
R3417:Plxnb1 UTSW 9 108,929,828 (GRCm39) missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 108,942,526 (GRCm39) unclassified probably benign
R3788:Plxnb1 UTSW 9 108,938,355 (GRCm39) missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 108,938,355 (GRCm39) missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 108,934,241 (GRCm39) missense probably benign 0.00
R4289:Plxnb1 UTSW 9 108,943,420 (GRCm39) missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 108,929,291 (GRCm39) missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 108,942,488 (GRCm39) missense probably benign 0.10
R4676:Plxnb1 UTSW 9 108,939,503 (GRCm39) missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 108,941,096 (GRCm39) missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 108,939,716 (GRCm39) missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 108,943,663 (GRCm39) missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 108,934,442 (GRCm39) missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 108,934,027 (GRCm39) missense probably benign 0.01
R4952:Plxnb1 UTSW 9 108,943,904 (GRCm39) missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 108,935,647 (GRCm39) missense probably benign 0.00
R5015:Plxnb1 UTSW 9 108,929,498 (GRCm39) missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 108,943,723 (GRCm39) missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 108,940,761 (GRCm39) splice site probably null
R5256:Plxnb1 UTSW 9 108,943,661 (GRCm39) missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 108,937,527 (GRCm39) missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 108,929,840 (GRCm39) missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 108,935,521 (GRCm39) missense probably benign 0.22
R5546:Plxnb1 UTSW 9 108,929,818 (GRCm39) missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 108,935,518 (GRCm39) missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 108,940,775 (GRCm39) missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 108,945,679 (GRCm39) missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 108,940,775 (GRCm39) missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 108,931,993 (GRCm39) splice site probably null
R6193:Plxnb1 UTSW 9 108,933,971 (GRCm39) missense probably benign
R6274:Plxnb1 UTSW 9 108,941,209 (GRCm39) critical splice donor site probably null
R6310:Plxnb1 UTSW 9 108,938,796 (GRCm39) missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 108,945,705 (GRCm39) missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 108,937,992 (GRCm39) missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 108,940,733 (GRCm39) missense possibly damaging 0.92
R6646:Plxnb1 UTSW 9 108,937,895 (GRCm39) missense probably benign
R6648:Plxnb1 UTSW 9 108,933,398 (GRCm39) missense probably benign 0.14
R6661:Plxnb1 UTSW 9 108,933,367 (GRCm39) missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 108,937,214 (GRCm39) missense probably benign 0.00
R6734:Plxnb1 UTSW 9 108,937,988 (GRCm39) nonsense probably null
R6859:Plxnb1 UTSW 9 108,935,838 (GRCm39) missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 108,945,702 (GRCm39) missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 108,941,375 (GRCm39) missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 108,929,453 (GRCm39) missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 108,929,243 (GRCm39) missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 108,937,236 (GRCm39) missense probably benign 0.01
R7428:Plxnb1 UTSW 9 108,937,236 (GRCm39) missense probably benign 0.01
R7443:Plxnb1 UTSW 9 108,943,675 (GRCm39) missense probably damaging 1.00
R7527:Plxnb1 UTSW 9 108,929,929 (GRCm39) missense probably damaging 0.99
R7645:Plxnb1 UTSW 9 108,943,480 (GRCm39) missense probably damaging 1.00
R7680:Plxnb1 UTSW 9 108,929,571 (GRCm39) nonsense probably null
R7866:Plxnb1 UTSW 9 108,929,525 (GRCm39) missense probably damaging 0.98
R7898:Plxnb1 UTSW 9 108,943,408 (GRCm39) missense probably damaging 1.00
R7905:Plxnb1 UTSW 9 108,938,300 (GRCm39) missense probably damaging 1.00
R8092:Plxnb1 UTSW 9 108,929,573 (GRCm39) missense probably damaging 1.00
R8150:Plxnb1 UTSW 9 108,941,146 (GRCm39) missense probably damaging 0.98
R8286:Plxnb1 UTSW 9 108,935,870 (GRCm39) missense probably damaging 1.00
R8290:Plxnb1 UTSW 9 108,938,687 (GRCm39) missense probably benign 0.00
R8987:Plxnb1 UTSW 9 108,937,178 (GRCm39) splice site probably benign
R9176:Plxnb1 UTSW 9 108,941,651 (GRCm39) missense probably damaging 1.00
R9231:Plxnb1 UTSW 9 108,934,286 (GRCm39) missense possibly damaging 0.59
R9698:Plxnb1 UTSW 9 108,925,251 (GRCm39) start gained probably benign
Z1177:Plxnb1 UTSW 9 108,937,989 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCAGCTTTGCCTATCAGGTGC -3'
(R):5'- TGGGGCAGACTAAACCACTC -3'

Sequencing Primer
(F):5'- AGGTGCCTGAACGCTAAAC -3'
(R):5'- CTCCCTGGAGTGTGTGGAC -3'
Posted On 2018-06-06