Incidental Mutation 'R6555:Slc16a10'
ID522092
Institutional Source Beutler Lab
Gene Symbol Slc16a10
Ensembl Gene ENSMUSG00000019838
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 10
SynonymsMct10, 2610103N14Rik, TAT1, PRO0813
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40033532-40142258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40080778 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 122 (I122V)
Ref Sequence ENSEMBL: ENSMUSP00000150416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092566] [ENSMUST00000213488]
Predicted Effect probably benign
Transcript: ENSMUST00000092566
AA Change: I122V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090227
Gene: ENSMUSG00000019838
AA Change: I122V

DomainStartEndE-ValueType
Pfam:MFS_1 66 320 1.1e-13 PFAM
Pfam:MFS_4 269 464 4.3e-11 PFAM
Pfam:MFS_1 291 507 4.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213488
AA Change: I122V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000213827
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced null allele exhibit altered amino acid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Slc16a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Slc16a10 APN 10 40076925 missense probably damaging 1.00
R0030:Slc16a10 UTSW 10 40076823 missense probably benign 0.04
R0196:Slc16a10 UTSW 10 40056615 missense probably benign 0.01
R0200:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0418:Slc16a10 UTSW 10 40040631 nonsense probably null
R0463:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0599:Slc16a10 UTSW 10 40141918 missense probably benign
R1162:Slc16a10 UTSW 10 40076553 missense probably benign 0.00
R1554:Slc16a10 UTSW 10 40076800 missense probably benign 0.00
R1901:Slc16a10 UTSW 10 40056606 nonsense probably null
R3622:Slc16a10 UTSW 10 40141894 missense probably benign
R3624:Slc16a10 UTSW 10 40141894 missense probably benign
R3717:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3719:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3729:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3730:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3731:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3801:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3803:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3804:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4037:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4038:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4254:Slc16a10 UTSW 10 40077001 missense probably damaging 1.00
R4980:Slc16a10 UTSW 10 40080805 missense probably damaging 1.00
R5498:Slc16a10 UTSW 10 40037327 missense probably damaging 0.99
R5542:Slc16a10 UTSW 10 40076788 missense probably benign 0.03
R6541:Slc16a10 UTSW 10 40037272 missense probably benign 0.00
R6998:Slc16a10 UTSW 10 40056503 missense possibly damaging 0.63
R7171:Slc16a10 UTSW 10 40037259 missense probably benign 0.03
R7354:Slc16a10 UTSW 10 40076955 missense probably damaging 1.00
R7414:Slc16a10 UTSW 10 40141996 missense probably benign 0.02
R7728:Slc16a10 UTSW 10 40040758 missense probably damaging 1.00
R7792:Slc16a10 UTSW 10 40037415 splice site probably null
R8366:Slc16a10 UTSW 10 40076871 missense probably benign 0.01
Z1177:Slc16a10 UTSW 10 40076971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGGCATACTGCTGATCTATG -3'
(R):5'- AAGTGTTGAGGCTTGCGAC -3'

Sequencing Primer
(F):5'- GGGATTCTCTTTGTAAACAGCGAAG -3'
(R):5'- CGACTGATTTGCTGTGGCCTC -3'
Posted On2018-06-06