Incidental Mutation 'R6555:Nup88'
ID522096
Institutional Source Beutler Lab
Gene Symbol Nup88
Ensembl Gene ENSMUSG00000040667
Gene Namenucleoporin 88
SynonymsNup84, Prei2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70943058-70969973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70944180 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 660 (R660G)
Ref Sequence ENSEMBL: ENSMUSP00000104170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035283] [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108530] [ENSMUST00000108531] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035283
AA Change: R671G

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048101
Gene: ENSMUSG00000040667
AA Change: R671G

DomainStartEndE-ValueType
Pfam:Nup88 13 752 1.1e-306 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076270
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081362
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100928
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108530
AA Change: R660G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104170
Gene: ENSMUSG00000040667
AA Change: R660G

DomainStartEndE-ValueType
Pfam:Nup88 11 742 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108531
AA Change: R665G

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104171
Gene: ENSMUSG00000040667
AA Change: R665G

DomainStartEndE-ValueType
Pfam:Nup88 11 747 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108533
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148168
Predicted Effect probably benign
Transcript: ENSMUST00000177731
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178245
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178253
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins, a family of 50 to 100 proteins, are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene belongs to the nucleoporin family and is associated with the oncogenic nucleoporin CAN/Nup214 in a dynamic subcomplex. This protein is also overexpressed in a large number of malignant neoplasms and precancerous dysplasias. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Nup88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Nup88 APN 11 70954654 splice site probably benign
IGL02219:Nup88 APN 11 70969692 missense probably benign 0.45
IGL02433:Nup88 APN 11 70969888 missense probably benign 0.13
IGL02666:Nup88 APN 11 70943869 intron probably benign
IGL02669:Nup88 APN 11 70956284 missense probably damaging 0.99
IGL02951:Nup88 APN 11 70944872 missense possibly damaging 0.94
unholy UTSW 11 70956192 missense probably damaging 1.00
PIT4515001:Nup88 UTSW 11 70944721 missense probably benign 0.00
R0445:Nup88 UTSW 11 70947729 missense probably benign 0.44
R0737:Nup88 UTSW 11 70969950 start codon destroyed probably null 0.90
R0920:Nup88 UTSW 11 70956320 missense possibly damaging 0.80
R1337:Nup88 UTSW 11 70944890 missense probably damaging 1.00
R2208:Nup88 UTSW 11 70965719 missense probably damaging 1.00
R3735:Nup88 UTSW 11 70956192 missense probably damaging 1.00
R4577:Nup88 UTSW 11 70969717 missense probably damaging 0.96
R4600:Nup88 UTSW 11 70969696 nonsense probably null
R4663:Nup88 UTSW 11 70965846 splice site probably null
R4812:Nup88 UTSW 11 70965726 missense probably damaging 1.00
R4824:Nup88 UTSW 11 70961624 missense probably benign 0.10
R5333:Nup88 UTSW 11 70945016 intron probably benign
R5338:Nup88 UTSW 11 70944908 missense probably damaging 0.98
R5443:Nup88 UTSW 11 70958430 nonsense probably null
R5605:Nup88 UTSW 11 70944070 intron probably benign
R5869:Nup88 UTSW 11 70969671 missense probably benign 0.01
R6287:Nup88 UTSW 11 70965755 missense probably benign 0.39
R6364:Nup88 UTSW 11 70947786 missense probably benign
R6409:Nup88 UTSW 11 70944972 missense probably null 0.71
R7203:Nup88 UTSW 11 70945254 missense probably benign 0.20
R7606:Nup88 UTSW 11 70961615 missense possibly damaging 0.89
R7620:Nup88 UTSW 11 70969779 missense probably benign 0.00
R7681:Nup88 UTSW 11 70969885 missense probably benign 0.05
R7956:Nup88 UTSW 11 70943874 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTCGCTGGTAGGCACTGAG -3'
(R):5'- TGGGTACTGCCAGTGTTCAC -3'

Sequencing Primer
(F):5'- GAGGACTCAGCACTTTTTCCATC -3'
(R):5'- CCCTTTGAAGTACTATGAAAGAGGAC -3'
Posted On2018-06-06