Incidental Mutation 'R6528:Med13'
ID 522101
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms Thrap1, 1110067M05Rik, Trap240
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R6528 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86267033-86357602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86298954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1043 (P1043L)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: P1043L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: P1043L

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Meta Mutation Damage Score 0.1985 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0197_Med13_854 UTSW 11 86307038 missense probably benign 0.13
R0360_Med13_060 UTSW 11 86329161 splice site probably benign
R2359_Med13_079 UTSW 11 86291035 splice site probably benign
R3735_Med13_085 UTSW 11 86279658 missense probably benign 0.00
R4974_Med13_508 UTSW 11 86298847 missense probably damaging 0.98
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R7922:Med13 UTSW 11 86271005 missense probably damaging 0.98
R7943:Med13 UTSW 11 86278526 missense probably damaging 0.97
R8062:Med13 UTSW 11 86319438 missense probably benign
R8075:Med13 UTSW 11 86272470 missense probably damaging 0.98
R8207:Med13 UTSW 11 86303549 missense probably damaging 1.00
R8671:Med13 UTSW 11 86271097 missense probably damaging 1.00
R9056:Med13 UTSW 11 86298834 nonsense probably null
R9084:Med13 UTSW 11 86300795 missense probably damaging 1.00
R9148:Med13 UTSW 11 86301471 missense probably benign 0.27
R9329:Med13 UTSW 11 86298457 missense probably benign 0.10
R9380:Med13 UTSW 11 86286772 missense probably benign 0.42
R9515:Med13 UTSW 11 86308901 missense probably benign 0.00
R9516:Med13 UTSW 11 86288975 missense probably benign 0.01
R9690:Med13 UTSW 11 86278844 missense probably damaging 1.00
R9751:Med13 UTSW 11 86299158 missense probably damaging 1.00
R9752:Med13 UTSW 11 86283321 missense possibly damaging 0.87
R9764:Med13 UTSW 11 86286519 missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCGATACTGTGCTTCTTGG -3'
(R):5'- TCTTTTGGGATGCCTCCGAG -3'

Sequencing Primer
(F):5'- GTTGGGTCTGGAATGTAAACTCCAAC -3'
(R):5'- GCAGCGCACCTCCTAGTAATG -3'
Posted On 2018-06-06