Incidental Mutation 'R6555:Ptprn2'
ID 522102
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 044680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R6555 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117190820 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 786 (Y786H)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably damaging
Transcript: ENSMUST00000070733
AA Change: Y786H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: Y786H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: Y786H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: Y786H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,752,468 (GRCm39) I480V probably damaging Het
Akap1 A T 11: 88,735,708 (GRCm39) I351N probably damaging Het
C1qtnf3 A G 15: 10,975,742 (GRCm39) M256V probably damaging Het
Carm1 T A 9: 21,498,258 (GRCm39) C421S probably damaging Het
Celsr2 T C 3: 108,302,235 (GRCm39) D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 (GRCm39) V319A probably damaging Het
Cntnap2 T A 6: 46,736,694 (GRCm39) W707R probably damaging Het
Ctss T A 3: 95,450,340 (GRCm39) L97* probably null Het
Eif2ak4 A T 2: 118,258,350 (GRCm39) N455Y probably damaging Het
Ercc6 G A 14: 32,239,064 (GRCm39) E51K probably benign Het
Gm10318 G A 10: 77,688,855 (GRCm39) probably benign Het
Gp6 C T 7: 4,387,929 (GRCm39) R180Q probably damaging Het
Gtsf1 T C 15: 103,333,902 (GRCm39) I25V probably damaging Het
Igkv1-99 A G 6: 68,519,300 (GRCm39) R85G probably damaging Het
Il36a G A 2: 24,114,611 (GRCm39) probably null Het
Iqsec3 T C 6: 121,361,178 (GRCm39) H935R probably damaging Het
Loxhd1 T C 18: 77,380,965 (GRCm39) V94A possibly damaging Het
Lrp2 T C 2: 69,339,647 (GRCm39) K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Lyst A G 13: 13,823,510 (GRCm39) N1494S probably benign Het
Mta3 C T 17: 84,015,875 (GRCm39) R26W probably damaging Het
Nup88 T C 11: 70,835,006 (GRCm39) R660G possibly damaging Het
Or1o1 G A 17: 37,716,796 (GRCm39) R119H probably benign Het
Or4q3 G A 14: 50,583,303 (GRCm39) Q168* probably null Het
Or5d16 T A 2: 87,773,632 (GRCm39) E113D probably damaging Het
Or8b51 C A 9: 38,569,585 (GRCm39) M34I probably benign Het
Pcdhga10 A G 18: 37,882,488 (GRCm39) T750A probably damaging Het
Plxnb1 A G 9: 108,937,473 (GRCm39) probably null Het
Ppip5k1 T C 2: 121,168,093 (GRCm39) E720G probably damaging Het
Pramel27 A G 4: 143,578,140 (GRCm39) I133M possibly damaging Het
Safb2 A G 17: 56,874,600 (GRCm39) V614A probably damaging Het
Safb2 A G 17: 56,889,982 (GRCm39) probably null Het
Selp C T 1: 163,969,171 (GRCm39) probably null Het
Slc16a10 T C 10: 39,956,774 (GRCm39) I122V probably benign Het
Slc22a22 G A 15: 57,122,527 (GRCm39) T131M probably benign Het
Trmt2a A T 16: 18,071,067 (GRCm39) I574F probably benign Het
Tsen54 C T 11: 115,711,519 (GRCm39) T156I probably benign Het
Vps13b A G 15: 35,846,993 (GRCm39) N2592S probably damaging Het
Wdr64 G A 1: 175,547,856 (GRCm39) R131H probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTAAAGCACATGGAGCC -3'
(R):5'- AATCATCCCAAGTTCCTGTTAGG -3'

Sequencing Primer
(F):5'- GCACATGGAGCCCACAAGG -3'
(R):5'- TAGGAAACTGCCCTTGCTG -3'
Posted On 2018-06-06