Incidental Mutation 'R6555:Olfr735'
ID522108
Institutional Source Beutler Lab
Gene Symbol Olfr735
Ensembl Gene ENSMUSG00000046210
Gene Nameolfactory receptor 735
SynonymsMOR243-1, GA_x6K02T2PMLR-6042130-6041183
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50342612-50348872 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 50345846 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 168 (Q168*)
Ref Sequence ENSEMBL: ENSMUSP00000153148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049729] [ENSMUST00000216634]
Predicted Effect probably null
Transcript: ENSMUST00000049729
AA Change: Q199*
SMART Domains Protein: ENSMUSP00000056851
Gene: ENSMUSG00000046210
AA Change: Q199*

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:7tm_4 70 345 1.6e-49 PFAM
Pfam:7tm_1 80 345 1.8e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216634
AA Change: Q168*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Olfr735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr735 APN 14 50345614 missense probably damaging 0.99
IGL01655:Olfr735 APN 14 50346184 missense probably benign 0.01
IGL02838:Olfr735 APN 14 50345855 missense probably damaging 1.00
IGL02874:Olfr735 APN 14 50346126 missense probably damaging 1.00
R0609:Olfr735 UTSW 14 50345926 missense probably damaging 1.00
R0724:Olfr735 UTSW 14 50345917 missense possibly damaging 0.89
R0839:Olfr735 UTSW 14 50346088 missense probably damaging 0.98
R1766:Olfr735 UTSW 14 50346220 missense probably damaging 1.00
R1799:Olfr735 UTSW 14 50346080 missense probably benign 0.32
R4934:Olfr735 UTSW 14 50345888 missense probably damaging 1.00
R5753:Olfr735 UTSW 14 50345588 missense probably damaging 0.96
R5996:Olfr735 UTSW 14 50345512 missense possibly damaging 0.89
R6736:Olfr735 UTSW 14 50345448 missense probably damaging 1.00
R7841:Olfr735 UTSW 14 50345828 missense probably benign 0.09
R7922:Olfr735 UTSW 14 50346415 missense probably benign 0.03
R8190:Olfr735 UTSW 14 50345722 missense probably damaging 0.99
R8308:Olfr735 UTSW 14 50345465 missense probably benign 0.06
R8560:Olfr735 UTSW 14 50346337 missense probably benign 0.12
X0019:Olfr735 UTSW 14 50345806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCGTCAAGTGAGAAGC -3'
(R):5'- CTGTGTGGCTGTACCCAAAATG -3'

Sequencing Primer
(F):5'- ACAGGTGGACAGTGCCTTG -3'
(R):5'- TGGCTGTACCCAAAATGCTAGG -3'
Posted On2018-06-06