Incidental Mutation 'R6555:C1qtnf3'
ID522110
Institutional Source Beutler Lab
Gene Symbol C1qtnf3
Ensembl Gene ENSMUSG00000058914
Gene NameC1q and tumor necrosis factor related protein 3
SynonymsCorcs, CTRP3, 2310005P21Rik, CORS-26
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10952332-10980150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10975656 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 256 (M256V)
Ref Sequence ENSEMBL: ENSMUSP00000106152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022853] [ENSMUST00000110523]
Predicted Effect probably benign
Transcript: ENSMUST00000022853
AA Change: M183V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022853
Gene: ENSMUSG00000058914
AA Change: M183V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
C1Q 111 245 2.26e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110523
AA Change: M256V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106152
Gene: ENSMUSG00000058914
AA Change: M256V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
C1Q 184 318 2.26e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in C1qtnf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:C1qtnf3 APN 15 10960682 missense probably damaging 1.00
IGL02491:C1qtnf3 APN 15 10971981 missense possibly damaging 0.69
mimosa_pudica UTSW 15 10958070 critical splice donor site probably null
R0083:C1qtnf3 UTSW 15 10975632 missense possibly damaging 0.89
R1136:C1qtnf3 UTSW 15 10978584 missense probably damaging 0.98
R1447:C1qtnf3 UTSW 15 10952649 missense probably damaging 1.00
R1510:C1qtnf3 UTSW 15 10975636 missense probably benign 0.05
R4536:C1qtnf3 UTSW 15 10972027 missense probably damaging 0.98
R5397:C1qtnf3 UTSW 15 10978541 missense probably damaging 0.99
R5833:C1qtnf3 UTSW 15 10975630 missense probably benign 0.06
R6483:C1qtnf3 UTSW 15 10958070 critical splice donor site probably null
R7324:C1qtnf3 UTSW 15 10952621 missense probably benign 0.04
R7456:C1qtnf3 UTSW 15 10972051 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGTCATAGCAACAGGCCATG -3'
(R):5'- GACTGCACTAGTTTCTTGCTGC -3'

Sequencing Primer
(F):5'- TAGCAACAGGCCATGAAGAAACTAC -3'
(R):5'- TTGGTTAACTCAGGTGGCAAAC -3'
Posted On2018-06-06