Mutagenetix > Incidental Mutation

Incidental Mutation 'R6528:Trps1'

522117

Institutional Source

Beutler Lab

Gene Symbol

Trps1

Ensembl Gene

ENSMUSG00000038679

Gene Name

transcriptional repressor GATA binding 1

Synonyms

D15Ertd586e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6528 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50654752-50890463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50822427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 114 (I114T)

Ref Sequence

ENSEMBL: ENSMUSP00000138835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183421] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000077935
AA Change: I780T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: I780T

Domain	Start	End	E-Value	Type
ZnF_C2H2	222	247	1.41e0	SMART
ZnF_C2H2	333	358	4.45e0	SMART
ZnF_C2H2	434	459	1.31e2	SMART
ZnF_C2H2	523	554	1.93e2	SMART
low complexity region	597	602	N/A	INTRINSIC
ZnF_C2H2	614	637	8.67e-1	SMART
ZnF_C2H2	666	689	2.29e0	SMART
ZnF_C2H2	692	715	8.22e-2	SMART
low complexity region	766	779	N/A	INTRINSIC
ZnF_GATA	890	940	3.95e-16	SMART
low complexity region	1050	1062	N/A	INTRINSIC
ZnF_C2H2	1215	1237	4.34e0	SMART
ZnF_C2H2	1243	1267	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165201
AA Change: I780T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: I780T

Domain	Start	End	E-Value	Type
ZnF_C2H2	222	247	1.41e0	SMART
ZnF_C2H2	333	358	4.45e0	SMART
ZnF_C2H2	434	459	1.31e2	SMART
ZnF_C2H2	523	554	1.93e2	SMART
low complexity region	597	602	N/A	INTRINSIC
ZnF_C2H2	614	637	8.67e-1	SMART
ZnF_C2H2	666	689	2.29e0	SMART
ZnF_C2H2	692	715	8.22e-2	SMART
low complexity region	766	779	N/A	INTRINSIC
ZnF_GATA	890	940	3.95e-16	SMART
low complexity region	1050	1062	N/A	INTRINSIC
ZnF_C2H2	1215	1237	4.34e0	SMART
ZnF_C2H2	1243	1267	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183421
AA Change: I114T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000138835
Gene: ENSMUSG00000038679
AA Change: I114T

Domain	Start	End	E-Value	Type
ZnF_C2H2	26	49	8.22e-2	SMART
low complexity region	100	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183757
AA Change: I784T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: I784T

Domain	Start	End	E-Value	Type
ZnF_C2H2	226	251	1.41e0	SMART
ZnF_C2H2	337	362	4.45e0	SMART
ZnF_C2H2	438	463	1.31e2	SMART
ZnF_C2H2	527	558	1.93e2	SMART
low complexity region	601	606	N/A	INTRINSIC
ZnF_C2H2	618	641	8.67e-1	SMART
ZnF_C2H2	670	693	2.29e0	SMART
ZnF_C2H2	696	719	8.22e-2	SMART
low complexity region	770	783	N/A	INTRINSIC
ZnF_GATA	894	944	3.95e-16	SMART
low complexity region	1054	1066	N/A	INTRINSIC
ZnF_C2H2	1219	1241	4.34e0	SMART
ZnF_C2H2	1247	1271	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183997
AA Change: I584T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: I584T

Domain	Start	End	E-Value	Type
ZnF_C2H2	226	251	1.41e0	SMART
ZnF_C2H2	337	362	4.45e0	SMART
ZnF_C2H2	470	493	2.29e0	SMART
ZnF_C2H2	496	519	8.22e-2	SMART
low complexity region	570	583	N/A	INTRINSIC
ZnF_GATA	705	755	3.95e-16	SMART
low complexity region	865	877	N/A	INTRINSIC
ZnF_C2H2	1030	1052	4.34e0	SMART
ZnF_C2H2	1058	1082	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184458
AA Change: I493T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: I493T

Domain	Start	End	E-Value	Type
ZnF_C2H2	46	71	4.45e0	SMART
ZnF_C2H2	147	172	1.31e2	SMART
ZnF_C2H2	236	267	1.93e2	SMART
low complexity region	310	315	N/A	INTRINSIC
ZnF_C2H2	327	350	8.67e-1	SMART
ZnF_C2H2	379	402	2.29e0	SMART
ZnF_C2H2	405	428	8.22e-2	SMART
low complexity region	479	492	N/A	INTRINSIC
ZnF_GATA	603	653	3.95e-16	SMART
low complexity region	763	775	N/A	INTRINSIC
ZnF_C2H2	928	950	4.34e0	SMART
ZnF_C2H2	956	980	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184885
AA Change: I534T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: I534T

Domain	Start	End	E-Value	Type
ZnF_C2H2	176	201	1.41e0	SMART
ZnF_C2H2	287	312	4.45e0	SMART
ZnF_C2H2	420	443	2.29e0	SMART
ZnF_C2H2	446	469	8.22e-2	SMART
low complexity region	520	533	N/A	INTRINSIC
ZnF_GATA	644	694	3.95e-16	SMART
low complexity region	804	816	N/A	INTRINSIC
ZnF_C2H2	969	991	4.34e0	SMART
ZnF_C2H2	997	1021	5.72e-1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam29	C	T	8: 55,872,561	R286H	possibly damaging	Het
Arhgap29	T	A	3: 122,014,702	N1176K	probably benign	Het
C87977	A	G	4: 144,208,811	V120A	probably damaging	Het
Cacfd1	T	G	2: 27,018,939	D97E	probably benign	Het
Ccnj	C	A	19: 40,832,085		probably null	Het
Chad	A	G	11: 94,565,624	Y176C	probably damaging	Het
Chd5	T	C	4: 152,356,676	L191P	probably damaging	Het
Cmtm1	T	C	8: 104,309,295	D190G	possibly damaging	Het
Cyp3a16	C	T	5: 145,440,431	A449T	probably damaging	Het
Eml5	T	C	12: 98,824,637	E1334G	probably benign	Het
Endou	C	T	15: 97,719,629	E147K	probably damaging	Het
Fbxo21	C	A	5: 118,000,356	H449N	probably benign	Het
Fkbp15	A	G	4: 62,332,270	I363T	probably damaging	Het
Gm12887	C	A	4: 121,615,637	G103C	probably damaging	Het
Gm14410	T	A	2: 177,193,508	H321L	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Irgm2	C	T	11: 58,220,052	P202S	probably benign	Het
Khsrp	G	A	17: 57,023,543	T551I	probably damaging	Het
Lpin2	T	A	17: 71,244,005	I720N	probably damaging	Het
Lypd8	G	A	11: 58,384,613	G58E	probably damaging	Het
Mdn1	G	T	4: 32,713,780	L1952F	probably damaging	Het
Med13	G	A	11: 86,298,954	P1043L	probably damaging	Het
Mycbp2	T	C	14: 103,142,881	T3832A	probably damaging	Het
Nrxn3	C	T	12: 89,513,049	R654C	probably damaging	Het
Olfr1082	T	C	2: 86,594,465	D121G	probably damaging	Het
Olfr512	T	C	7: 108,713,431	L14P	probably damaging	Het
Olfr530	G	T	7: 140,373,441	H56Q	possibly damaging	Het
Olfr535	A	G	7: 140,493,051	M138V	probably damaging	Het
Pcdhb6	A	G	18: 37,334,503	D159G	probably damaging	Het
Plec	T	C	15: 76,174,430	E3759G	probably damaging	Het
Plekho1	C	T	3: 95,989,321	D236N	probably damaging	Het
Pnma1	T	A	12: 84,147,423	I169F	probably benign	Het
Ppl	T	A	16: 5,087,616	H1605L	probably benign	Het
Ppp2r2b	T	A	18: 42,688,338	M252L	probably benign	Het
Prickle4	T	A	17: 47,689,333	R246*	probably null	Het
Rad50	G	A	11: 53,652,282	T1235I	probably damaging	Het
Ranbp10	T	C	8: 105,779,956	N244S	probably damaging	Het
Robo4	T	C	9: 37,404,368	S306P	possibly damaging	Het
Shox2	C	A	3: 66,981,285	R91L	probably benign	Het
Tbx5	A	G	5: 119,883,111	E394G	probably damaging	Het
Tcl1b5	A	G	12: 105,178,999	N74S	probably benign	Het
Tgif1	G	A	17: 70,846,560		probably benign	Het
Tmem128	T	A	5: 38,266,499		probably null	Het
Trio	A	G	15: 27,805,870	S511P	probably damaging	Het
Ttll8	G	T	15: 88,914,238	Q765K	probably benign	Het
Usp17ld	A	T	7: 103,250,755	D323E	probably damaging	Het
Vmn1r232	G	A	17: 20,914,047	T97I	probably benign	Het
Vmn2r28	T	A	7: 5,490,685	R87S	probably benign	Het
Vps26b	C	G	9: 27,010,466	E254D	probably benign	Het
Vps8	C	A	16: 21,554,125	Y113*	probably null	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Xcr1	A	T	9: 123,855,983	I238N	probably damaging	Het
Zar1l	T	A	5: 150,507,130	E272V	probably damaging	Het
Zfp451	A	G	1: 33,777,781	Y146H	probably damaging	Het
Zfp54	G	T	17: 21,433,474	E77*	probably null	Het

Other mutations in Trps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Trps1	APN	15	50846870	missense	probably benign	0.07
IGL00497:Trps1	APN	15	50661307	missense	possibly damaging	0.91
IGL00558:Trps1	APN	15	50661085	missense	probably damaging	1.00
IGL01325:Trps1	APN	15	50846814	missense	probably benign	0.40
IGL02132:Trps1	APN	15	50822278	missense	probably damaging	1.00
IGL02631:Trps1	APN	15	50846021	missense	probably damaging	1.00
IGL02740:Trps1	APN	15	50846539	missense	probably damaging	1.00
IGL02821:Trps1	APN	15	50660877	missense	probably damaging	1.00
IGL03096:Trps1	APN	15	50846479	missense	probably benign
F5770:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
R0050:Trps1	UTSW	15	50765525	missense	probably benign	0.18
R0244:Trps1	UTSW	15	50664743	missense	probably damaging	1.00
R0377:Trps1	UTSW	15	50831778	nonsense	probably null
R0599:Trps1	UTSW	15	50831860	nonsense	probably null
R0848:Trps1	UTSW	15	50661549	missense	possibly damaging	0.54
R1744:Trps1	UTSW	15	50661213	missense	probably damaging	1.00
R1830:Trps1	UTSW	15	50661136	missense	probably damaging	0.99
R2083:Trps1	UTSW	15	50822305	missense	probably damaging	1.00
R2167:Trps1	UTSW	15	50831730	missense	possibly damaging	0.94
R2267:Trps1	UTSW	15	50822398	missense	probably damaging	1.00
R2314:Trps1	UTSW	15	50661346	missense	probably damaging	1.00
R3735:Trps1	UTSW	15	50846060	missense	possibly damaging	0.94
R4133:Trps1	UTSW	15	50831387	missense	probably damaging	1.00
R4223:Trps1	UTSW	15	50846648	missense	probably benign
R4280:Trps1	UTSW	15	50846082	missense	probably benign	0.00
R4566:Trps1	UTSW	15	50831678	missense	probably damaging	1.00
R4810:Trps1	UTSW	15	50822296	missense	probably benign	0.14
R4828:Trps1	UTSW	15	50660677	makesense	probably null
R4838:Trps1	UTSW	15	50827316	missense	probably benign	0.05
R4852:Trps1	UTSW	15	50846309	missense	probably damaging	1.00
R5001:Trps1	UTSW	15	50661307	missense	possibly damaging	0.91
R5311:Trps1	UTSW	15	50664760	missense	probably damaging	1.00
R5463:Trps1	UTSW	15	50831890	nonsense	probably null
R5677:Trps1	UTSW	15	50846108	missense	probably damaging	1.00
R5691:Trps1	UTSW	15	50827304	missense	probably benign
R6432:Trps1	UTSW	15	50831397	missense	probably damaging	0.96
R6594:Trps1	UTSW	15	50830955	missense	probably damaging	0.99
R6827:Trps1	UTSW	15	50822563	missense	probably benign	0.14
R6862:Trps1	UTSW	15	50831605	critical splice donor site	probably null
R6912:Trps1	UTSW	15	50822298	missense	possibly damaging	0.92
R7151:Trps1	UTSW	15	50822397	missense	possibly damaging	0.95
R7846:Trps1	UTSW	15	50831877	missense	probably damaging	0.99
R7857:Trps1	UTSW	15	50661005	missense	probably damaging	1.00
R7986:Trps1	UTSW	15	50661736	missense	probably damaging	1.00
R7986:Trps1	UTSW	15	50889623	missense	probably benign	0.00
R8744:Trps1	UTSW	15	50661246	missense	probably damaging	1.00
R8838:Trps1	UTSW	15	50889611	missense	probably benign	0.01
R8859:Trps1	UTSW	15	50822373	missense	possibly damaging	0.77
R8935:Trps1	UTSW	15	50888948	nonsense	probably null
R9044:Trps1	UTSW	15	50822607	missense	probably benign	0.11
R9142:Trps1	UTSW	15	50661262	missense	probably damaging	0.98
R9211:Trps1	UTSW	15	50831444	missense	probably damaging	1.00
R9283:Trps1	UTSW	15	50831051	missense	probably damaging	1.00
R9363:Trps1	UTSW	15	50661280	missense	probably damaging	1.00
R9402:Trps1	UTSW	15	50846256	missense	probably damaging	1.00
R9562:Trps1	UTSW	15	50661261	missense	probably damaging	1.00
R9647:Trps1	UTSW	15	50661548	missense	probably benign	0.09
R9803:Trps1	UTSW	15	50846694	missense	possibly damaging	0.94
V7580:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
V7581:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
V7583:Trps1	UTSW	15	50831577	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGGGCAGCTTCAACATTG -3'
(R):5'- CTCAGTCACTATTGGAGCACTTC -3'

Sequencing Primer
(F):5'- CAGCTTCAACATTGGGGCTGTC -3'
(R):5'- TTGGAGCACTTCAACACAGTTC -3'

Posted On

2018-06-06