Incidental Mutation 'R6528:Trps1'
ID522117
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50822427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 114 (I114T)
Ref Sequence ENSEMBL: ENSMUSP00000138835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183421] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
Predicted Effect probably benign
Transcript: ENSMUST00000077935
AA Change: I780T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: I780T

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165201
AA Change: I780T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: I780T

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183421
AA Change: I114T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000138835
Gene: ENSMUSG00000038679
AA Change: I114T

DomainStartEndE-ValueType
ZnF_C2H2 26 49 8.22e-2 SMART
low complexity region 100 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183757
AA Change: I784T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: I784T

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183997
AA Change: I584T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: I584T

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184458
AA Change: I493T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: I493T

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184885
AA Change: I534T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: I534T

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
R7929:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7940:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGGCAGCTTCAACATTG -3'
(R):5'- CTCAGTCACTATTGGAGCACTTC -3'

Sequencing Primer
(F):5'- CAGCTTCAACATTGGGGCTGTC -3'
(R):5'- TTGGAGCACTTCAACACAGTTC -3'
Posted On2018-06-06