Incidental Mutation 'R6555:Safb2'
ID522122
Institutional Source Beutler Lab
Gene Symbol Safb2
Ensembl Gene ENSMUSG00000042625
Gene Namescaffold attachment factor B2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56560965-56584585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56567600 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 614 (V614A)
Ref Sequence ENSEMBL: ENSMUSP00000074953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075510] [ENSMUST00000131056] [ENSMUST00000133604] [ENSMUST00000142940] [ENSMUST00000144255] [ENSMUST00000154991] [ENSMUST00000155983]
Predicted Effect probably damaging
Transcript: ENSMUST00000075510
AA Change: V614A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074953
Gene: ENSMUSG00000042625
AA Change: V614A

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
coiled coil region 262 285 N/A INTRINSIC
low complexity region 286 294 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
RRM 452 525 1.33e-19 SMART
low complexity region 557 578 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
coiled coil region 658 772 N/A INTRINSIC
low complexity region 798 815 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124111
SMART Domains Protein: ENSMUSP00000120845
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
low complexity region 59 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127947
Predicted Effect possibly damaging
Transcript: ENSMUST00000131056
AA Change: V101A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120750
Gene: ENSMUSG00000042625
AA Change: V101A

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
coiled coil region 146 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133604
SMART Domains Protein: ENSMUSP00000119324
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134741
Predicted Effect probably benign
Transcript: ENSMUST00000142752
SMART Domains Protein: ENSMUSP00000119141
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
low complexity region 42 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142940
SMART Domains Protein: ENSMUSP00000123229
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
coiled coil region 22 136 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144255
SMART Domains Protein: ENSMUSP00000123673
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154991
SMART Domains Protein: ENSMUSP00000117696
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
coiled coil region 23 137 N/A INTRINSIC
low complexity region 163 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155983
SMART Domains Protein: ENSMUSP00000116363
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156640
SMART Domains Protein: ENSMUSP00000118127
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
low complexity region 62 86 N/A INTRINSIC
Meta Mutation Damage Score 0.2350 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, along with its paralog (scaffold attachment factor B1), is a repressor of estrogen receptor alpha. The encoded protein binds scaffold/matrix attachment region (S/MAR) DNA and is involved in cell cycle regulation, apoptosis, differentiation, the stress response, and regulation of immune genes. [provided by RefSeq, May 2016]
PHENOTYPE: Male homozyous mutant mice exhibit an increase in testis weight and an increased number of Sertoli cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Mta3 C T 17: 83,708,446 R26W probably damaging Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Safb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Safb2 APN 17 56571208 critical splice donor site probably null
IGL00954:Safb2 APN 17 56578639 critical splice donor site probably null
IGL01085:Safb2 APN 17 56565242 nonsense probably null
IGL03073:Safb2 APN 17 56571289 missense probably benign 0.06
R0748:Safb2 UTSW 17 56575580 missense probably benign 0.30
R1297:Safb2 UTSW 17 56584265 unclassified probably benign
R1876:Safb2 UTSW 17 56576909 splice site probably null
R2921:Safb2 UTSW 17 56568906 missense possibly damaging 0.46
R3966:Safb2 UTSW 17 56575356 missense probably null 1.00
R5140:Safb2 UTSW 17 56577901 missense probably benign 0.01
R5484:Safb2 UTSW 17 56575346 intron probably benign
R5542:Safb2 UTSW 17 56575647 missense probably damaging 0.97
R5602:Safb2 UTSW 17 56575630 missense possibly damaging 0.65
R5801:Safb2 UTSW 17 56563103 missense possibly damaging 0.96
R5864:Safb2 UTSW 17 56566491 unclassified probably benign
R5985:Safb2 UTSW 17 56563181 missense possibly damaging 0.72
R6060:Safb2 UTSW 17 56563246 splice site probably null
R6279:Safb2 UTSW 17 56563226 missense possibly damaging 0.53
R6300:Safb2 UTSW 17 56563226 missense possibly damaging 0.53
R6411:Safb2 UTSW 17 56571289 missense probably benign 0.06
R6555:Safb2 UTSW 17 56582982 critical splice donor site probably null
R7039:Safb2 UTSW 17 56564594 missense possibly damaging 0.82
R7515:Safb2 UTSW 17 56582982 critical splice donor site probably null
R7796:Safb2 UTSW 17 56566327 missense possibly damaging 0.53
X0066:Safb2 UTSW 17 56565978 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCTCATGCTTAGACTAAGATTCTTCTG -3'
(R):5'- TGCCACCCACTGAGGAAATG -3'

Sequencing Primer
(F):5'- GACTAAGATTCTTCTGAACCTGTGG -3'
(R):5'- CCACTGAGGAAATGTGCCCATTG -3'
Posted On2018-06-06