Incidental Mutation 'R6528:Ttll8'
ID522123
Institutional Source Beutler Lab
Gene Symbol Ttll8
Ensembl Gene ENSMUSG00000022388
Gene Nametubulin tyrosine ligase-like family, member 8
Synonyms1700019P01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location88890633-88954418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88914238 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 765 (Q765K)
Ref Sequence ENSEMBL: ENSMUSP00000104996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109371] [ENSMUST00000177180]
Predicted Effect probably benign
Transcript: ENSMUST00000109371
AA Change: Q765K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104996
Gene: ENSMUSG00000022388
AA Change: Q765K

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
Pfam:TTL 324 621 3.9e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137740
Predicted Effect probably benign
Transcript: ENSMUST00000177180
SMART Domains Protein: ENSMUSP00000135381
Gene: ENSMUSG00000022388

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177254
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Ttll8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ttll8 APN 15 88914153 missense probably benign
IGL00895:Ttll8 APN 15 88933528 missense probably damaging 1.00
IGL01061:Ttll8 APN 15 88917250 missense possibly damaging 0.85
IGL01661:Ttll8 APN 15 88935999 splice site probably benign
IGL01992:Ttll8 APN 15 88915645 missense possibly damaging 0.48
IGL02212:Ttll8 APN 15 88917247 missense probably benign 0.04
IGL02234:Ttll8 APN 15 88914049 missense possibly damaging 0.53
IGL02569:Ttll8 APN 15 88933926 nonsense probably null
IGL02935:Ttll8 APN 15 88914556 missense probably benign 0.10
IGL03064:Ttll8 APN 15 88919594 missense probably benign 0.22
R0969:Ttll8 UTSW 15 88933935 missense probably damaging 1.00
R1637:Ttll8 UTSW 15 88914444 missense probably benign 0.12
R1939:Ttll8 UTSW 15 88915486 missense probably damaging 1.00
R1992:Ttll8 UTSW 15 88914451 missense probably benign 0.00
R2173:Ttll8 UTSW 15 88914597 missense probably damaging 1.00
R2201:Ttll8 UTSW 15 88933953 missense possibly damaging 0.57
R2414:Ttll8 UTSW 15 88936133 splice site probably benign
R2905:Ttll8 UTSW 15 88914477 missense probably benign 0.00
R4159:Ttll8 UTSW 15 88917241 missense probably benign 0.00
R4368:Ttll8 UTSW 15 88914181 missense possibly damaging 0.88
R4395:Ttll8 UTSW 15 88915580 missense possibly damaging 0.80
R4707:Ttll8 UTSW 15 88917090 missense probably damaging 0.99
R4926:Ttll8 UTSW 15 88914165 missense probably damaging 0.98
R4983:Ttll8 UTSW 15 88925582 missense probably benign 0.08
R5698:Ttll8 UTSW 15 88939006 missense possibly damaging 0.85
R5752:Ttll8 UTSW 15 88932728 missense probably benign 0.00
R5834:Ttll8 UTSW 15 88917246 missense possibly damaging 0.48
R5889:Ttll8 UTSW 15 88933939 missense probably damaging 1.00
R6931:Ttll8 UTSW 15 88914304 missense possibly damaging 0.55
R7133:Ttll8 UTSW 15 88915427 missense probably damaging 0.99
R7268:Ttll8 UTSW 15 88934956 critical splice donor site probably null
R7286:Ttll8 UTSW 15 88917239 missense probably benign 0.01
R7502:Ttll8 UTSW 15 88933436 critical splice donor site probably null
R7580:Ttll8 UTSW 15 88933929 missense probably damaging 0.99
R7734:Ttll8 UTSW 15 88914165 missense probably damaging 0.98
R8074:Ttll8 UTSW 15 88915375 missense probably damaging 1.00
X0058:Ttll8 UTSW 15 88917130 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGGAGAATACAGCTTGAAGG -3'
(R):5'- AGTGATCAGGCCTCCAAGAAC -3'

Sequencing Primer
(F):5'- GAATACAGCTTGAAGGTCGTCTC -3'
(R):5'- TCCAAGAACGACCGTGCG -3'
Posted On2018-06-06