Incidental Mutation 'R6555:Mta3'
ID522126
Institutional Source Beutler Lab
Gene Symbol Mta3
Ensembl Gene ENSMUSG00000055817
Gene Namemetastasis associated 3
Synonyms1110002J22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R6555 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location83706163-83821516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83708446 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 26 (R26W)
Ref Sequence ENSEMBL: ENSMUSP00000107971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067826] [ENSMUST00000112349] [ENSMUST00000112350] [ENSMUST00000112352] [ENSMUST00000177069]
Predicted Effect probably damaging
Transcript: ENSMUST00000067826
AA Change: R26W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068931
Gene: ENSMUSG00000055817
AA Change: R26W

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 203 3.49e-16 SMART
SANT 266 315 7.94e-8 SMART
ZnF_GATA 371 425 8.33e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112349
AA Change: R26W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107968
Gene: ENSMUSG00000055817
AA Change: R26W

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 373 427 8.33e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112350
AA Change: R26W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107969
Gene: ENSMUSG00000055817
AA Change: R26W

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 372 426 8.33e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112352
AA Change: R26W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107971
Gene: ENSMUSG00000055817
AA Change: R26W

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 372 426 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177069
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,468 I480V probably damaging Het
Akap1 A T 11: 88,844,882 I351N probably damaging Het
C1qtnf3 A G 15: 10,975,656 M256V probably damaging Het
Carm1 T A 9: 21,586,962 C421S probably damaging Het
Celsr2 T C 3: 108,394,919 D2631G probably damaging Het
Cfap206 A G 4: 34,719,049 V319A probably damaging Het
Cntnap2 T A 6: 46,759,760 W707R probably damaging Het
Ctss T A 3: 95,543,029 L97* probably null Het
Eif2ak4 A T 2: 118,427,869 N455Y probably damaging Het
Ercc6 G A 14: 32,517,107 E51K probably benign Het
Gm10318 G A 10: 77,853,021 probably benign Het
Gm13103 A G 4: 143,851,570 I133M possibly damaging Het
Gp6 C T 7: 4,384,930 R180Q probably damaging Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Igkv1-99 A G 6: 68,542,316 R85G probably damaging Het
Il1f6 G A 2: 24,224,599 probably null Het
Iqsec3 T C 6: 121,384,219 H935R probably damaging Het
Loxhd1 T C 18: 77,293,269 V94A possibly damaging Het
Lrp2 T C 2: 69,509,303 K1088R probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Lyst A G 13: 13,648,925 N1494S probably benign Het
Nup88 T C 11: 70,944,180 R660G possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1155 T A 2: 87,943,288 E113D probably damaging Het
Olfr735 G A 14: 50,345,846 Q168* probably null Het
Olfr916 C A 9: 38,658,289 M34I probably benign Het
Pcdhga10 A G 18: 37,749,435 T750A probably damaging Het
Plxnb1 A G 9: 109,108,405 probably null Het
Ppip5k1 T C 2: 121,337,612 E720G probably damaging Het
Ptprn2 T C 12: 117,227,200 Y786H probably damaging Het
Safb2 A G 17: 56,567,600 V614A probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Selp C T 1: 164,141,602 probably null Het
Slc16a10 T C 10: 40,080,778 I122V probably benign Het
Slc22a22 G A 15: 57,259,131 T131M probably benign Het
Trmt2a A T 16: 18,253,203 I574F probably benign Het
Tsen54 C T 11: 115,820,693 T156I probably benign Het
Vps13b A G 15: 35,846,847 N2592S probably damaging Het
Wdr64 G A 1: 175,720,290 R131H probably damaging Het
Other mutations in Mta3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00467:Mta3 APN 17 83755684 splice site probably benign
IGL00475:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00539:Mta3 APN 17 83762983 missense probably benign 0.25
IGL01722:Mta3 APN 17 83755643 missense possibly damaging 0.95
IGL03355:Mta3 APN 17 83800045 splice site probably benign
container UTSW 17 83708446 missense probably damaging 1.00
R0440:Mta3 UTSW 17 83766587 missense probably damaging 1.00
R0630:Mta3 UTSW 17 83714627 missense probably damaging 0.98
R1848:Mta3 UTSW 17 83755551 splice site probably benign
R1870:Mta3 UTSW 17 83781968 missense probably damaging 0.98
R2358:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R2373:Mta3 UTSW 17 83784301 nonsense probably null
R2447:Mta3 UTSW 17 83804544 missense probably benign 0.03
R3711:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R3712:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R4107:Mta3 UTSW 17 83762914 missense probably benign 0.00
R4771:Mta3 UTSW 17 83755674 missense probably damaging 0.98
R5259:Mta3 UTSW 17 83804574 missense probably damaging 1.00
R5980:Mta3 UTSW 17 83708405 missense probably damaging 1.00
R6175:Mta3 UTSW 17 83791793 missense probably benign
R6909:Mta3 UTSW 17 83766551 missense possibly damaging 0.92
R7170:Mta3 UTSW 17 83714662 missense probably damaging 1.00
R7350:Mta3 UTSW 17 83708441 missense probably damaging 1.00
R7597:Mta3 UTSW 17 83775582 missense probably benign 0.05
R7638:Mta3 UTSW 17 83800143 missense probably benign
R7747:Mta3 UTSW 17 83791736 nonsense probably null
R7894:Mta3 UTSW 17 83762934 missense probably benign 0.01
R7977:Mta3 UTSW 17 83762934 missense probably benign 0.01
Z1088:Mta3 UTSW 17 83762914 missense probably benign 0.00
Z1177:Mta3 UTSW 17 83781968 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGCATAGGGAATTGTAGCCC -3'
(R):5'- GCCTGATCTTCAAGGTTCAAAGC -3'

Sequencing Primer
(F):5'- TCTGGTGAACAAGGCAAGCTCTC -3'
(R):5'- CTTCAAGGTTCAAAGCAATCTGAAG -3'
Posted On2018-06-06