Incidental Mutation 'R6528:Vmn1r232'
ID522131
Institutional Source Beutler Lab
Gene Symbol Vmn1r232
Ensembl Gene ENSMUSG00000062165
Gene Namevomeronasal 1 receptor 232
SynonymsV1re4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20913205-20914363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20914047 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 97 (T97I)
Ref Sequence ENSEMBL: ENSMUSP00000076261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077001]
Predicted Effect probably benign
Transcript: ENSMUST00000077001
AA Change: T97I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076261
Gene: ENSMUSG00000062165
AA Change: T97I

DomainStartEndE-ValueType
Pfam:TAS2R 46 331 6.9e-7 PFAM
Pfam:7tm_1 70 324 1e-6 PFAM
Pfam:V1R 78 338 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Vmn1r232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Vmn1r232 APN 17 20914132 missense probably benign 0.07
IGL02576:Vmn1r232 APN 17 20913913 missense probably benign 0.30
H8562:Vmn1r232 UTSW 17 20913394 missense probably benign 0.29
R1182:Vmn1r232 UTSW 17 20913443 missense possibly damaging 0.95
R2010:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R2088:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R2206:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2207:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2273:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2274:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2275:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2443:Vmn1r232 UTSW 17 20913384 missense probably damaging 1.00
R2516:Vmn1r232 UTSW 17 20914026 missense possibly damaging 0.65
R3700:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R5256:Vmn1r232 UTSW 17 20913584 missense probably damaging 1.00
R5418:Vmn1r232 UTSW 17 20914116 missense possibly damaging 0.75
R5726:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R5833:Vmn1r232 UTSW 17 20913651 missense probably damaging 1.00
R7019:Vmn1r232 UTSW 17 20913285 missense possibly damaging 0.76
R7600:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
Z1088:Vmn1r232 UTSW 17 20913838 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTGCCTGGAAGACACTCAAG -3'
(R):5'- TGCACATACATGTCCCAACTTAG -3'

Sequencing Primer
(F):5'- CACTCAAGAGACAAGTGGTGATAATG -3'
(R):5'- TGTCCCAACTTAGAAAACTTACTTC -3'
Posted On2018-06-06