Incidental Mutation 'R6528:Zfp54'
ID522133
Institutional Source Beutler Lab
Gene Symbol Zfp54
Ensembl Gene ENSMUSG00000023882
Gene Namezinc finger protein 54
SynonymsKRAB10, Zfp-54, Zfp76, clone 18
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21423227-21435640 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 21433474 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 77 (E77*)
Ref Sequence ENSEMBL: ENSMUSP00000127089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007884] [ENSMUST00000165230] [ENSMUST00000167749]
Predicted Effect probably null
Transcript: ENSMUST00000007884
AA Change: E77*
SMART Domains Protein: ENSMUSP00000007884
Gene: ENSMUSG00000023882
AA Change: E77*

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165230
AA Change: E77*
SMART Domains Protein: ENSMUSP00000132983
Gene: ENSMUSG00000023882
AA Change: E77*

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167749
AA Change: E77*
SMART Domains Protein: ENSMUSP00000127089
Gene: ENSMUSG00000023882
AA Change: E77*

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232563
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Other mutations in Zfp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp54 APN 17 21433559 missense possibly damaging 0.62
IGL00425:Zfp54 APN 17 21430297 missense probably damaging 1.00
IGL02830:Zfp54 APN 17 21433456 missense probably damaging 1.00
IGL03037:Zfp54 APN 17 21430215 missense probably damaging 0.99
R1853:Zfp54 UTSW 17 21434142 nonsense probably null
R1855:Zfp54 UTSW 17 21434142 nonsense probably null
R1915:Zfp54 UTSW 17 21434152 missense probably benign
R3803:Zfp54 UTSW 17 21433552 missense possibly damaging 0.58
R4430:Zfp54 UTSW 17 21434960 missense probably damaging 0.98
R4724:Zfp54 UTSW 17 21433403 missense probably damaging 0.96
R4799:Zfp54 UTSW 17 21434140 missense probably damaging 1.00
R5197:Zfp54 UTSW 17 21434180 missense probably benign 0.12
R5400:Zfp54 UTSW 17 21433700 missense probably benign 0.05
R5422:Zfp54 UTSW 17 21434526 missense probably benign 0.00
R5566:Zfp54 UTSW 17 21433444 missense probably damaging 0.99
R6460:Zfp54 UTSW 17 21433742 missense probably benign
R6876:Zfp54 UTSW 17 21433977 missense probably damaging 1.00
R7296:Zfp54 UTSW 17 21433582 missense probably benign 0.11
R7342:Zfp54 UTSW 17 21427752 start gained probably benign
R7660:Zfp54 UTSW 17 21434239 missense probably damaging 1.00
R7701:Zfp54 UTSW 17 21434095 missense probably benign 0.02
R7796:Zfp54 UTSW 17 21434720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTTGAAGACTATTACTCGG -3'
(R):5'- CGCACAGTCTTTAGATTCACAAC -3'

Sequencing Primer
(F):5'- CCATGAGTTCTATGCTAAGTACTTC -3'
(R):5'- AGATTCACAACGTTCTTTTCCAGTG -3'
Posted On2018-06-06