Incidental Mutation 'R6556:Olfr1261'
ID522136
Institutional Source Beutler Lab
Gene Symbol Olfr1261
Ensembl Gene ENSMUSG00000061295
Gene Nameolfactory receptor 1261
SynonymsGA_x6K02T2Q125-51425355-51426275, MOR234-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89991221-89996189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89994173 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 260 (F260Y)
Ref Sequence ENSEMBL: ENSMUSP00000150711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077785] [ENSMUST00000111509] [ENSMUST00000213909] [ENSMUST00000216953]
Predicted Effect probably benign
Transcript: ENSMUST00000077785
AA Change: F260Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076959
Gene: ENSMUSG00000061295
AA Change: F260Y

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-26 PFAM
Pfam:7tm_4 134 275 4.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111509
SMART Domains Protein: ENSMUSP00000107134
Gene: ENSMUSG00000061295

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.8e-41 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213909
AA Change: F260Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216953
AA Change: F260Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Olfr1261
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Olfr1261 APN 2 89994312 missense probably benign 0.00
R0140:Olfr1261 UTSW 2 89994119 missense probably damaging 1.00
R0220:Olfr1261 UTSW 2 89993862 missense probably benign 0.08
R0243:Olfr1261 UTSW 2 89993806 missense probably benign 0.01
R1644:Olfr1261 UTSW 2 89993953 missense possibly damaging 0.60
R1669:Olfr1261 UTSW 2 89993800 splice site probably null
R1916:Olfr1261 UTSW 2 89993804 missense probably benign
R3620:Olfr1261 UTSW 2 89993852 missense probably damaging 1.00
R4190:Olfr1261 UTSW 2 89993574 nonsense probably null
R5260:Olfr1261 UTSW 2 89994182 missense probably damaging 1.00
R5591:Olfr1261 UTSW 2 89993407 missense possibly damaging 0.95
R5907:Olfr1261 UTSW 2 89993957 missense probably benign 0.01
R5910:Olfr1261 UTSW 2 89993438 missense probably benign 0.29
R6044:Olfr1261 UTSW 2 89993417 missense possibly damaging 0.89
R7083:Olfr1261 UTSW 2 89993857 missense probably benign
R7439:Olfr1261 UTSW 2 89993839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCGGGTCACTGTGTTTACTC -3'
(R):5'- CCACCATTTAAGGAGAACAACTGTC -3'

Sequencing Primer
(F):5'- GCGGGTCACTGTGTTTACTCATTTTC -3'
(R):5'- TGTCCATTGAACAGCGCTAAAG -3'
Posted On2018-06-06