Incidental Mutation 'R6528:Lpin2'
ID522141
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Namelipin 2
Synonyms2610511G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location71182560-71249817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71244005 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 720 (I720N)
Ref Sequence ENSEMBL: ENSMUSP00000119282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125665
Predicted Effect probably damaging
Transcript: ENSMUST00000126681
AA Change: I758N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: I758N

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129635
AA Change: I720N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: I720N

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140150
Predicted Effect probably benign
Transcript: ENSMUST00000154507
SMART Domains Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_mid 1 55 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.9197 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71237378 splice site probably null
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5100:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71243372 missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71244803 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5869:Lpin2 UTSW 17 71232276 unclassified probably benign
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71231269 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6634:Lpin2 UTSW 17 71246418 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
R7583:Lpin2 UTSW 17 71231396 nonsense probably null
R7806:Lpin2 UTSW 17 71245171 missense probably damaging 1.00
R7840:Lpin2 UTSW 17 71230274 missense probably benign 0.14
R8011:Lpin2 UTSW 17 71230375 missense probably benign 0.43
Z1176:Lpin2 UTSW 17 71225211 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATTGTACCCGGCTTGCAC -3'
(R):5'- AGCCTTCCCAATCAATTCTAGG -3'

Sequencing Primer
(F):5'- GGCTTGCACCCCCATTTAGTG -3'
(R):5'- TATGACTACACAGGTAAGTCAGC -3'
Posted On2018-06-06