Mutagenetix > Incidental Mutations

Incidental Mutation 'R6556:Uox'

522142

Institutional Source

Beutler Lab

Gene Symbol

Uox

Ensembl Gene

ENSMUSG00000028186

Gene Name

urate oxidase

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.491) question?

Stock #

R6556 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

146570426-146632305 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to C at 146624648 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000199489]

Predicted Effect

probably null
Transcript: ENSMUST00000029837

SMART Domains

Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186

Domain	Start	End	E-Value	Type
Pfam:Uricase	19	144	8.7e-25	PFAM
Pfam:Uricase	153	292	5.6e-38	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000121133

SMART Domains

Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186

Domain	Start	End	E-Value	Type
Pfam:Uricase	2	72	1.2e-19	PFAM
Pfam:Uricase	79	181	8.5e-23	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000199489

SMART Domains

Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186

Domain	Start	End	E-Value	Type
Pfam:Uricase	1	121	8.3e-35	PFAM
Pfam:Uricase	128	228	1.8e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029P11Rik	A	G	15: 81,980,738	D60G	probably damaging	Het
2310035C23Rik	T	A	1: 105,726,440	F845I	probably damaging	Het
4930539E08Rik	T	A	17: 28,904,611	D114V	probably damaging	Het
AF366264	G	A	8: 13,837,690	Q134*	probably null	Het
Atp2a1	G	T	7: 126,450,262	P536Q	probably benign	Het
Cabyr	T	A	18: 12,751,016	S187T	probably benign	Het
Camkk1	A	T	11: 73,033,870	N303I	probably benign	Het
Cdh13	C	T	8: 118,968,187	P259S	probably damaging	Het
Csnk1g3	A	G	18: 53,930,282	D255G	possibly damaging	Het
Dennd5b	A	C	6: 149,014,251		probably null	Het
Dnajc14	A	G	10: 128,814,631	D528G	probably benign	Het
Edem1	T	C	6: 108,854,357	F593S	probably benign	Het
Erbb2	G	A	11: 98,436,082	D1106N	possibly damaging	Het
Ermp1	T	C	19: 29,612,921	M794V	possibly damaging	Het
Fam208a	T	G	14: 27,429,258	Y64D	probably benign	Het
Fam214b	C	T	4: 43,033,896	R460H	probably damaging	Het
Fip1l1	T	A	5: 74,547,177		probably null	Het
Gm11639	A	G	11: 105,008,251	N4343S	probably null	Het
Gm20730	C	T	6: 43,081,542	C112Y	probably damaging	Het
Gtf2h1	T	A	7: 46,808,665	C245S	probably damaging	Het
Hdhd5	T	C	6: 120,523,554	H61R	probably benign	Het
Ighv1-71	A	T	12: 115,742,472	V31E	probably damaging	Het
Igsf9b	T	C	9: 27,329,555	F688S	probably damaging	Het
Iqcd	T	C	5: 120,602,378	V258A	probably damaging	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Lpo	G	T	11: 87,817,763	Y136*	probably null	Het
Med30	A	G	15: 52,730,383		probably benign	Het
Mertk	T	A	2: 128,776,421	V524D	probably benign	Het
Olfr1156	T	C	2: 87,949,976	I86V	probably benign	Het
Olfr1261	T	A	2: 89,994,173	F260Y	probably benign	Het
Olfr1263	T	C	2: 90,015,094	Y55H	probably damaging	Het
Pde6b	T	A	5: 108,421,501	M358K	possibly damaging	Het
Prep	GA	G	10: 45,158,314		probably null	Het
Prpf4b	G	A	13: 34,896,032	R793Q	probably damaging	Het
Rela	T	A	19: 5,647,338	N524K	probably damaging	Het
Rnaset2a	T	C	17: 8,141,648	D74G	probably damaging	Het
Serinc2	T	A	4: 130,258,271	I267F	probably damaging	Het
Sesn3	T	C	9: 14,321,253	F274S	possibly damaging	Het
Spag1	T	C	15: 36,195,407	Y249H	probably damaging	Het
Sstr1	A	T	12: 58,213,692	D367V	possibly damaging	Het
Tnnt1	T	C	7: 4,509,577	E110G	probably damaging	Het
Tpm1	T	A	9: 67,028,169		probably null	Het
Unc93b1	T	C	19: 3,944,105	V412A	probably benign	Het
Usp44	T	C	10: 93,846,008	Y107H	probably benign	Het

Other mutations in Uox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Uox	APN	3	146627810	missense	probably benign	0.00
IGL00902:Uox	APN	3	146610406	missense	possibly damaging	0.95
IGL02409:Uox	APN	3	146624626	missense	probably benign	0.06
IGL02827:Uox	APN	3	146597196	intron	probably benign
IGL02979:Uox	APN	3	146610491	splice site	probably null
IGL03375:Uox	APN	3	146625835	missense	probably damaging	1.00
kamloops	UTSW	3	146624577	nonsense	probably null
R1350:Uox	UTSW	3	146624575	missense	probably damaging	1.00
R1634:Uox	UTSW	3	146612383	nonsense	probably null
R1900:Uox	UTSW	3	146610379	missense	probably damaging	1.00
R2000:Uox	UTSW	3	146610399	missense	possibly damaging	0.65
R2119:Uox	UTSW	3	146612542	missense	probably benign	0.01
R5329:Uox	UTSW	3	146624545	missense	probably damaging	1.00
R5606:Uox	UTSW	3	146610302	nonsense	probably null
R6281:Uox	UTSW	3	146624577	nonsense	probably null
R6327:Uox	UTSW	3	146624577	nonsense	probably null
R6337:Uox	UTSW	3	146624577	nonsense	probably null
R6364:Uox	UTSW	3	146624577	nonsense	probably null
R6365:Uox	UTSW	3	146624577	nonsense	probably null
R6369:Uox	UTSW	3	146624577	nonsense	probably null
R6483:Uox	UTSW	3	146624577	nonsense	probably null
R6492:Uox	UTSW	3	146624577	nonsense	probably null
R6494:Uox	UTSW	3	146624577	nonsense	probably null
R6803:Uox	UTSW	3	146612509	missense	possibly damaging	0.91
R7809:Uox	UTSW	3	146627858	nonsense	probably null
R7868:Uox	UTSW	3	146610274	missense	probably benign	0.01
R8131:Uox	UTSW	3	146625834	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTCTGGAATCAAAGACCTC -3'
(R):5'- GCATGTATGTCTGAGAGTCACTG -3'

Sequencing Primer
(F):5'- CAAGGTCTTGAAAACAACCCAGTCTG -3'
(R):5'- GAAACACCATCTGGAGTTGTTCG -3'

Posted On

2018-06-06