Incidental Mutation 'R6556:Uox'
ID 522142
Institutional Source Beutler Lab
Gene Symbol Uox
Ensembl Gene ENSMUSG00000028186
Gene Name urate oxidase
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock # R6556 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 146570426-146632305 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to C at 146624648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000199489]
AlphaFold P25688
Predicted Effect probably null
Transcript: ENSMUST00000029837
SMART Domains Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 19 144 8.7e-25 PFAM
Pfam:Uricase 153 292 5.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121133
SMART Domains Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 2 72 1.2e-19 PFAM
Pfam:Uricase 79 181 8.5e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199489
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Uox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Uox APN 3 146627810 missense probably benign 0.00
IGL00902:Uox APN 3 146610406 missense possibly damaging 0.95
IGL02409:Uox APN 3 146624626 missense probably benign 0.06
IGL02827:Uox APN 3 146597196 intron probably benign
IGL02979:Uox APN 3 146610491 splice site probably null
IGL03375:Uox APN 3 146625835 missense probably damaging 1.00
kamloops UTSW 3 146624577 nonsense probably null
vancouver UTSW 3 146612292 missense probably damaging 1.00
R1350:Uox UTSW 3 146624575 missense probably damaging 1.00
R1634:Uox UTSW 3 146612383 nonsense probably null
R1900:Uox UTSW 3 146610379 missense probably damaging 1.00
R2000:Uox UTSW 3 146610399 missense possibly damaging 0.65
R2119:Uox UTSW 3 146612542 missense probably benign 0.01
R5329:Uox UTSW 3 146624545 missense probably damaging 1.00
R5606:Uox UTSW 3 146610302 nonsense probably null
R6281:Uox UTSW 3 146624577 nonsense probably null
R6327:Uox UTSW 3 146624577 nonsense probably null
R6337:Uox UTSW 3 146624577 nonsense probably null
R6364:Uox UTSW 3 146624577 nonsense probably null
R6365:Uox UTSW 3 146624577 nonsense probably null
R6369:Uox UTSW 3 146624577 nonsense probably null
R6483:Uox UTSW 3 146624577 nonsense probably null
R6492:Uox UTSW 3 146624577 nonsense probably null
R6494:Uox UTSW 3 146624577 nonsense probably null
R6803:Uox UTSW 3 146612509 missense possibly damaging 0.91
R7809:Uox UTSW 3 146627858 nonsense probably null
R7868:Uox UTSW 3 146610274 missense probably benign 0.01
R8131:Uox UTSW 3 146625834 missense probably damaging 1.00
R8931:Uox UTSW 3 146612292 missense probably damaging 1.00
R9088:Uox UTSW 3 146624614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTCTGGAATCAAAGACCTC -3'
(R):5'- GCATGTATGTCTGAGAGTCACTG -3'

Sequencing Primer
(F):5'- CAAGGTCTTGAAAACAACCCAGTCTG -3'
(R):5'- GAAACACCATCTGGAGTTGTTCG -3'
Posted On 2018-06-06