Incidental Mutation 'R6528:Pcdhb6'
ID 522143
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Name protocadherin beta 6
Synonyms Pcdhb5B, PcdhbF
MMRRC Submission 044654-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R6528 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37466913-37470491 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37467556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 159 (D159G)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
AlphaFold Q91XZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000061717
AA Change: D159G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: D159G

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Meta Mutation Damage Score 0.2663 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 56,325,596 (GRCm39) R286H possibly damaging Het
Arhgap29 T A 3: 121,808,351 (GRCm39) N1176K probably benign Het
Cacfd1 T G 2: 26,908,951 (GRCm39) D97E probably benign Het
Ccnj C A 19: 40,820,529 (GRCm39) probably null Het
Chad A G 11: 94,456,450 (GRCm39) Y176C probably damaging Het
Chd5 T C 4: 152,441,133 (GRCm39) L191P probably damaging Het
Cmtm1 T C 8: 105,035,927 (GRCm39) D190G possibly damaging Het
Cyp3a16 C T 5: 145,377,241 (GRCm39) A449T probably damaging Het
Eml5 T C 12: 98,790,896 (GRCm39) E1334G probably benign Het
Endou C T 15: 97,617,510 (GRCm39) E147K probably damaging Het
Fbxo21 C A 5: 118,138,421 (GRCm39) H449N probably benign Het
Fkbp15 A G 4: 62,250,507 (GRCm39) I363T probably damaging Het
Gm12887 C A 4: 121,472,834 (GRCm39) G103C probably damaging Het
Gm14410 T A 2: 176,885,301 (GRCm39) H321L probably damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Irgm2 C T 11: 58,110,878 (GRCm39) P202S probably benign Het
Khsrp G A 17: 57,330,543 (GRCm39) T551I probably damaging Het
Lpin2 T A 17: 71,551,000 (GRCm39) I720N probably damaging Het
Lypd8 G A 11: 58,275,439 (GRCm39) G58E probably damaging Het
Mdn1 G T 4: 32,713,780 (GRCm39) L1952F probably damaging Het
Med13 G A 11: 86,189,780 (GRCm39) P1043L probably damaging Het
Mycbp2 T C 14: 103,380,317 (GRCm39) T3832A probably damaging Het
Nrxn3 C T 12: 89,479,819 (GRCm39) R654C probably damaging Het
Or10a3m T C 7: 108,312,638 (GRCm39) L14P probably damaging Het
Or12j3 G T 7: 139,953,354 (GRCm39) H56Q possibly damaging Het
Or13a22 A G 7: 140,072,964 (GRCm39) M138V probably damaging Het
Or8k35 T C 2: 86,424,809 (GRCm39) D121G probably damaging Het
Plec T C 15: 76,058,630 (GRCm39) E3759G probably damaging Het
Plekho1 C T 3: 95,896,633 (GRCm39) D236N probably damaging Het
Pnma1 T A 12: 84,194,197 (GRCm39) I169F probably benign Het
Ppl T A 16: 4,905,480 (GRCm39) H1605L probably benign Het
Ppp2r2b T A 18: 42,821,403 (GRCm39) M252L probably benign Het
Pramel29 A G 4: 143,935,381 (GRCm39) V120A probably damaging Het
Prickle4 T A 17: 48,000,258 (GRCm39) R246* probably null Het
Rad50 G A 11: 53,543,109 (GRCm39) T1235I probably damaging Het
Ranbp10 T C 8: 106,506,588 (GRCm39) N244S probably damaging Het
Robo4 T C 9: 37,315,664 (GRCm39) S306P possibly damaging Het
Shox2 C A 3: 66,888,618 (GRCm39) R91L probably benign Het
Tbx5 A G 5: 120,021,176 (GRCm39) E394G probably damaging Het
Tcl1b5 A G 12: 105,145,258 (GRCm39) N74S probably benign Het
Tgif1 G A 17: 71,153,555 (GRCm39) probably benign Het
Tmem128 T A 5: 38,423,843 (GRCm39) probably null Het
Trio A G 15: 27,805,956 (GRCm39) S511P probably damaging Het
Trps1 A G 15: 50,685,823 (GRCm39) I114T probably benign Het
Ttll8 G T 15: 88,798,441 (GRCm39) Q765K probably benign Het
Usp17ld A T 7: 102,899,962 (GRCm39) D323E probably damaging Het
Vmn1r232 G A 17: 21,134,309 (GRCm39) T97I probably benign Het
Vmn2r28 T A 7: 5,493,684 (GRCm39) R87S probably benign Het
Vps26b C G 9: 26,921,762 (GRCm39) E254D probably benign Het
Vps8 C A 16: 21,372,875 (GRCm39) Y113* probably null Het
Wwc1 C T 11: 35,744,264 (GRCm39) E853K probably benign Het
Xcr1 A T 9: 123,685,048 (GRCm39) I238N probably damaging Het
Zar1l T A 5: 150,430,595 (GRCm39) E272V probably damaging Het
Zfp451 A G 1: 33,816,862 (GRCm39) Y146H probably damaging Het
Zfp54 G T 17: 21,653,736 (GRCm39) E77* probably null Het
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37,467,277 (GRCm39) missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37,468,873 (GRCm39) missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37,468,735 (GRCm39) missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37,468,507 (GRCm39) missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37,467,747 (GRCm39) missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37,468,640 (GRCm39) nonsense probably null
IGL03144:Pcdhb6 APN 18 37,467,459 (GRCm39) missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37,469,205 (GRCm39) missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37,467,585 (GRCm39) missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37,469,190 (GRCm39) missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37,468,300 (GRCm39) missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37,468,167 (GRCm39) missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37,468,387 (GRCm39) missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37,467,640 (GRCm39) missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37,468,633 (GRCm39) missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37,468,633 (GRCm39) missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37,469,284 (GRCm39) missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37,468,222 (GRCm39) missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37,468,945 (GRCm39) missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37,468,945 (GRCm39) missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37,469,193 (GRCm39) missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37,469,259 (GRCm39) missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37,468,426 (GRCm39) missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37,467,381 (GRCm39) missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37,467,388 (GRCm39) missense possibly damaging 0.95
R5465:Pcdhb6 UTSW 18 37,467,783 (GRCm39) missense probably damaging 0.97
R5522:Pcdhb6 UTSW 18 37,467,402 (GRCm39) missense probably benign
R5556:Pcdhb6 UTSW 18 37,467,442 (GRCm39) missense probably damaging 1.00
R5703:Pcdhb6 UTSW 18 37,467,753 (GRCm39) missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37,467,966 (GRCm39) missense probably benign 0.00
R6256:Pcdhb6 UTSW 18 37,468,978 (GRCm39) missense probably damaging 0.98
R6304:Pcdhb6 UTSW 18 37,468,974 (GRCm39) nonsense probably null
R6883:Pcdhb6 UTSW 18 37,468,198 (GRCm39) missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37,469,329 (GRCm39) missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37,468,531 (GRCm39) missense probably benign
R7313:Pcdhb6 UTSW 18 37,468,261 (GRCm39) missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37,468,225 (GRCm39) missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37,468,332 (GRCm39) missense possibly damaging 0.60
R7606:Pcdhb6 UTSW 18 37,468,659 (GRCm39) missense probably damaging 0.99
R7701:Pcdhb6 UTSW 18 37,467,562 (GRCm39) missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37,469,365 (GRCm39) missense probably benign 0.05
R7905:Pcdhb6 UTSW 18 37,467,607 (GRCm39) missense probably benign 0.00
R7982:Pcdhb6 UTSW 18 37,467,273 (GRCm39) nonsense probably null
R8818:Pcdhb6 UTSW 18 37,468,837 (GRCm39) missense probably benign 0.06
R8917:Pcdhb6 UTSW 18 37,468,431 (GRCm39) missense possibly damaging 0.92
R9397:Pcdhb6 UTSW 18 37,469,353 (GRCm39) missense probably benign 0.00
Z1088:Pcdhb6 UTSW 18 37,468,199 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCTGCACTTCCAGATC -3'
(R):5'- ATGTCCACGACTTCAATTCGAACAG -3'

Sequencing Primer
(F):5'- GTGCTGCACTTCCAGATCATACTAG -3'
(R):5'- TCAATTCGAACAGTGGTAGTCCCAG -3'
Posted On 2018-06-06