Incidental Mutation 'R6556:Serinc2'
ID 522146
Institutional Source Beutler Lab
Gene Symbol Serinc2
Ensembl Gene ENSMUSG00000023232
Gene Name serine incorporator 2
Synonyms Tde2l, 2310004K20Rik, FKSG84, TDE2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R6556 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 130147289-130172993 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130152064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 267 (I267F)
Ref Sequence ENSEMBL: ENSMUSP00000112535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105996] [ENSMUST00000120126] [ENSMUST00000122374] [ENSMUST00000146478]
AlphaFold Q8K0E7
Predicted Effect probably damaging
Transcript: ENSMUST00000105996
AA Change: I322F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232
AA Change: I322F

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120126
AA Change: I331F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232
AA Change: I331F

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122374
AA Change: I267F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232
AA Change: I267F

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146478
SMART Domains Protein: ENSMUSP00000115198
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 148 1.9e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atosb C T 4: 43,033,896 (GRCm39) R460H probably damaging Het
Atp2a1 G T 7: 126,049,434 (GRCm39) P536Q probably benign Het
Bnip5 T A 17: 29,123,585 (GRCm39) D114V probably damaging Het
Cabyr T A 18: 12,884,073 (GRCm39) S187T probably benign Het
Camkk1 A T 11: 72,924,696 (GRCm39) N303I probably benign Het
Cdh13 C T 8: 119,694,926 (GRCm39) P259S probably damaging Het
Csnk1g3 A G 18: 54,063,354 (GRCm39) D255G possibly damaging Het
Dennd5b A C 6: 148,915,749 (GRCm39) probably null Het
Dnajc14 A G 10: 128,650,500 (GRCm39) D528G probably benign Het
Edem1 T C 6: 108,831,318 (GRCm39) F593S probably benign Het
Efcab3 A G 11: 104,899,077 (GRCm39) N4343S probably null Het
Erbb2 G A 11: 98,326,908 (GRCm39) D1106N possibly damaging Het
Ermp1 T C 19: 29,590,321 (GRCm39) M794V possibly damaging Het
Fip1l1 T A 5: 74,707,838 (GRCm39) probably null Het
Gm20730 C T 6: 43,058,476 (GRCm39) C112Y probably damaging Het
Gtf2h1 T A 7: 46,458,089 (GRCm39) C245S probably damaging Het
Hdhd5 T C 6: 120,500,515 (GRCm39) H61R probably benign Het
Ighv1-71 A T 12: 115,706,092 (GRCm39) V31E probably damaging Het
Igsf9b T C 9: 27,240,851 (GRCm39) F688S probably damaging Het
Iqcd T C 5: 120,740,443 (GRCm39) V258A probably damaging Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Lpo G T 11: 87,708,589 (GRCm39) Y136* probably null Het
Med30 A G 15: 52,593,779 (GRCm39) probably benign Het
Mertk T A 2: 128,618,341 (GRCm39) V524D probably benign Het
Ndufb11b A G 15: 81,864,939 (GRCm39) D60G probably damaging Het
Or4c126 T A 2: 89,824,517 (GRCm39) F260Y probably benign Het
Or4c52 T C 2: 89,845,438 (GRCm39) Y55H probably damaging Het
Or5l13 T C 2: 87,780,320 (GRCm39) I86V probably benign Het
Pde6b T A 5: 108,569,367 (GRCm39) M358K possibly damaging Het
Prep GA G 10: 45,034,410 (GRCm39) probably null Het
Prpf4b G A 13: 35,080,015 (GRCm39) R793Q probably damaging Het
Rela T A 19: 5,697,366 (GRCm39) N524K probably damaging Het
Relch T A 1: 105,654,165 (GRCm39) F845I probably damaging Het
Rnaset2a T C 17: 8,360,480 (GRCm39) D74G probably damaging Het
Semp2l2a G A 8: 13,887,690 (GRCm39) Q134* probably null Het
Sesn3 T C 9: 14,232,549 (GRCm39) F274S possibly damaging Het
Spag1 T C 15: 36,195,553 (GRCm39) Y249H probably damaging Het
Sstr1 A T 12: 58,260,478 (GRCm39) D367V possibly damaging Het
Tasor T G 14: 27,151,215 (GRCm39) Y64D probably benign Het
Tnnt1 T C 7: 4,512,576 (GRCm39) E110G probably damaging Het
Tpm1 T A 9: 66,935,451 (GRCm39) probably null Het
Unc93b1 T C 19: 3,994,105 (GRCm39) V412A probably benign Het
Uox G C 3: 146,330,403 (GRCm39) probably null Het
Usp44 T C 10: 93,681,870 (GRCm39) Y107H probably benign Het
Other mutations in Serinc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Serinc2 APN 4 130,158,201 (GRCm39) missense possibly damaging 0.88
IGL02031:Serinc2 APN 4 130,158,237 (GRCm39) nonsense probably null
IGL02551:Serinc2 APN 4 130,154,567 (GRCm39) missense probably benign 0.01
R1455:Serinc2 UTSW 4 130,158,133 (GRCm39) missense probably damaging 0.96
R1520:Serinc2 UTSW 4 130,154,543 (GRCm39) missense probably benign 0.00
R2059:Serinc2 UTSW 4 130,154,578 (GRCm39) missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130,159,005 (GRCm39) missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130,159,005 (GRCm39) missense probably damaging 1.00
R3160:Serinc2 UTSW 4 130,154,528 (GRCm39) missense probably benign
R3162:Serinc2 UTSW 4 130,154,528 (GRCm39) missense probably benign
R4497:Serinc2 UTSW 4 130,147,847 (GRCm39) missense possibly damaging 0.67
R4735:Serinc2 UTSW 4 130,157,438 (GRCm39) missense probably benign 0.13
R4987:Serinc2 UTSW 4 130,156,820 (GRCm39) splice site probably null
R5569:Serinc2 UTSW 4 130,172,272 (GRCm39) missense probably benign 0.17
R5681:Serinc2 UTSW 4 130,158,869 (GRCm39) missense probably damaging 1.00
R5946:Serinc2 UTSW 4 130,149,314 (GRCm39) missense possibly damaging 0.91
R6898:Serinc2 UTSW 4 130,149,235 (GRCm39) missense probably benign 0.13
R7264:Serinc2 UTSW 4 130,152,052 (GRCm39) missense probably benign 0.00
R7526:Serinc2 UTSW 4 130,152,583 (GRCm39) missense probably benign 0.03
R7835:Serinc2 UTSW 4 130,169,280 (GRCm39) missense unknown
R8744:Serinc2 UTSW 4 130,158,988 (GRCm39) start gained probably benign
R8819:Serinc2 UTSW 4 130,149,172 (GRCm39) missense probably damaging 1.00
R8820:Serinc2 UTSW 4 130,149,172 (GRCm39) missense probably damaging 1.00
R9335:Serinc2 UTSW 4 130,158,220 (GRCm39) missense probably benign 0.01
R9419:Serinc2 UTSW 4 130,149,315 (GRCm39) missense probably damaging 0.99
R9542:Serinc2 UTSW 4 130,152,516 (GRCm39) nonsense probably null
R9688:Serinc2 UTSW 4 130,158,133 (GRCm39) missense probably damaging 0.96
Z1176:Serinc2 UTSW 4 130,147,788 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGTCTGGTCCATAGCATTG -3'
(R):5'- GCCCTCTGCTATCCTCAAAG -3'

Sequencing Primer
(F):5'- TGAAGATCTGAGTTCAATCCCCGG -3'
(R):5'- AAGTTCCCTGACTCGTAGATCCAG -3'
Posted On 2018-06-06