Incidental Mutation 'R6556:Fip1l1'
ID522148
Institutional Source Beutler Lab
Gene Symbol Fip1l1
Ensembl Gene ENSMUSG00000029227
Gene NameFIP1 like 1 (S. cerevisiae)
Synonyms1300019H17Rik, Rje
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location74535449-74598800 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 74547177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080164] [ENSMUST00000113534] [ENSMUST00000113535] [ENSMUST00000113536] [ENSMUST00000120618]
Predicted Effect probably benign
Transcript: ENSMUST00000080164
SMART Domains Protein: ENSMUSP00000079059
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.2e-28 PFAM
low complexity region 296 357 N/A INTRINSIC
low complexity region 405 441 N/A INTRINSIC
low complexity region 453 507 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113534
SMART Domains Protein: ENSMUSP00000109162
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.1e-28 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113535
SMART Domains Protein: ENSMUSP00000109163
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 6.4e-29 PFAM
low complexity region 296 346 N/A INTRINSIC
low complexity region 396 432 N/A INTRINSIC
low complexity region 444 498 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113536
SMART Domains Protein: ENSMUSP00000109164
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.3e-28 PFAM
low complexity region 247 267 N/A INTRINSIC
low complexity region 332 393 N/A INTRINSIC
low complexity region 441 477 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
low complexity region 546 559 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120618
SMART Domains Protein: ENSMUSP00000113995
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Pfam:Fip1 137 181 2e-29 PFAM
low complexity region 255 275 N/A INTRINSIC
low complexity region 340 401 N/A INTRINSIC
low complexity region 449 485 N/A INTRINSIC
low complexity region 497 551 N/A INTRINSIC
low complexity region 554 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121950
SMART Domains Protein: ENSMUSP00000113611
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 153 195 6.6e-29 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
low complexity region 503 557 N/A INTRINSIC
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200979
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Fip1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Fip1l1 APN 5 74587065 splice site probably benign
IGL02008:Fip1l1 APN 5 74545423 missense possibly damaging 0.80
IGL02069:Fip1l1 APN 5 74591873 missense probably damaging 1.00
IGL02406:Fip1l1 APN 5 74564544 missense probably benign 0.01
IGL02514:Fip1l1 APN 5 74571152 missense probably damaging 1.00
IGL03139:Fip1l1 APN 5 74571115 missense possibly damaging 0.84
R0031:Fip1l1 UTSW 5 74557109 missense probably damaging 1.00
R0325:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0600:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0834:Fip1l1 UTSW 5 74595060 unclassified probably benign
R1183:Fip1l1 UTSW 5 74595102 missense probably damaging 1.00
R1328:Fip1l1 UTSW 5 74546135 missense possibly damaging 0.94
R2434:Fip1l1 UTSW 5 74546824 missense possibly damaging 0.81
R4120:Fip1l1 UTSW 5 74588191 missense probably damaging 1.00
R4197:Fip1l1 UTSW 5 74535736 missense probably damaging 1.00
R4440:Fip1l1 UTSW 5 74536785 intron probably benign
R4825:Fip1l1 UTSW 5 74588205 splice site probably null
R4838:Fip1l1 UTSW 5 74591939 missense probably damaging 1.00
R5800:Fip1l1 UTSW 5 74546081 missense possibly damaging 0.77
R6159:Fip1l1 UTSW 5 74591947 missense probably damaging 1.00
R6724:Fip1l1 UTSW 5 74591774 missense probably damaging 0.99
R6984:Fip1l1 UTSW 5 74542073 missense probably damaging 0.99
R7092:Fip1l1 UTSW 5 74536843 missense probably damaging 0.98
R7205:Fip1l1 UTSW 5 74588075 intron probably null
R7325:Fip1l1 UTSW 5 74536799 critical splice acceptor site probably null
R7590:Fip1l1 UTSW 5 74591774 missense probably benign 0.41
R8182:Fip1l1 UTSW 5 74588152 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCAGCTAGCTGTAGGCCAC -3'
(R):5'- GTGCCACCTATAATCACAGCAGAG -3'

Sequencing Primer
(F):5'- CACAGCTAGTTACTATTAATGTGGCC -3'
(R):5'- GCAGACAACAGCTTTACTTGG -3'
Posted On2018-06-06