Incidental Mutation 'R6529:Dnah14'
ID 522150
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 044655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6529 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 181494034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1730 (V1730D)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194470
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: V1730D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 78,739,479 (GRCm39) M296L probably benign Het
Atxn2 T C 5: 121,949,677 (GRCm39) probably null Het
B3galnt2 G T 13: 14,170,377 (GRCm39) R242S probably benign Het
Bltp3a A G 17: 28,098,750 (GRCm39) I218M possibly damaging Het
Casz1 G A 4: 149,022,646 (GRCm39) E571K probably damaging Het
Ccdc163 A G 4: 116,566,121 (GRCm39) probably null Het
Cd109 A G 9: 78,619,907 (GRCm39) D1383G probably damaging Het
Cd200r1 A G 16: 44,610,065 (GRCm39) T95A possibly damaging Het
Chd2 T C 7: 73,153,191 (GRCm39) E219G possibly damaging Het
Cibar1 A G 4: 12,168,978 (GRCm39) V175A probably damaging Het
Eps8 G A 6: 137,491,335 (GRCm39) H348Y possibly damaging Het
Fbxo2 A T 4: 148,249,511 (GRCm39) D187V probably damaging Het
Fsip2 A T 2: 82,812,657 (GRCm39) Y2992F probably benign Het
Gle1 A T 2: 29,825,539 (GRCm39) T10S possibly damaging Het
Got2 T C 8: 96,615,013 (GRCm39) probably benign Het
Gtf3c6 T C 10: 40,127,251 (GRCm39) T34A probably benign Het
H4c11 G T 13: 21,919,476 (GRCm39) V71F possibly damaging Het
Klf15 C T 6: 90,444,394 (GRCm39) T323I probably damaging Het
Krtap5-3 C A 7: 141,756,079 (GRCm39) C305* probably null Het
Map2k6 A T 11: 110,383,388 (GRCm39) D99V probably damaging Het
Nckap5l G T 15: 99,324,475 (GRCm39) P676Q probably benign Het
Nup188 A T 2: 30,216,466 (GRCm39) T757S possibly damaging Het
Or10ak13 C T 4: 118,638,907 (GRCm39) V292I probably benign Het
Or51q1c T C 7: 103,653,133 (GRCm39) V217A probably benign Het
Peg3 C A 7: 6,711,071 (GRCm39) A1384S probably damaging Het
Plekho2 C T 9: 65,480,383 (GRCm39) R14H probably benign Het
Qsox2 A T 2: 26,107,753 (GRCm39) C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 (GRCm39) V469A probably benign Het
Slitrk3 T C 3: 72,958,551 (GRCm39) T74A probably benign Het
Spmip7 T C 11: 11,465,009 (GRCm39) F120S possibly damaging Het
Sult1a1 T C 7: 126,274,310 (GRCm39) T91A probably benign Het
Sult3a2 T C 10: 33,655,733 (GRCm39) Y82C probably damaging Het
Taf1b A T 12: 24,606,650 (GRCm39) H490L possibly damaging Het
Trrap T A 5: 144,771,014 (GRCm39) H2804Q probably benign Het
Usp8 A G 2: 126,567,298 (GRCm39) I106V probably benign Het
Wdcp T A 12: 4,901,143 (GRCm39) V333D probably damaging Het
Wdr46 T A 17: 34,168,120 (GRCm39) L564Q possibly damaging Het
Wrn T C 8: 33,826,004 (GRCm39) probably null Het
Zfp664 C T 5: 124,963,352 (GRCm39) H249Y probably damaging Het
Zfp975 A C 7: 42,311,325 (GRCm39) H429Q possibly damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTGCTCAAAGGACAGTCTTC -3'
(R):5'- AGTGTGCTTAATGATCCTTCCAC -3'

Sequencing Primer
(F):5'- TGCTCAAAGGACAGTCTTCTAACCTG -3'
(R):5'- TGGACATGCCTGCAAAGTGC -3'
Posted On 2018-06-06