Incidental Mutation 'R6556:Edem1'
ID522156
Institutional Source Beutler Lab
Gene Symbol Edem1
Ensembl Gene ENSMUSG00000030104
Gene NameER degradation enhancer, mannosidase alpha-like 1
SynonymsA130059K23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location108828641-108859356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108854357 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 593 (F593S)
Ref Sequence ENSEMBL: ENSMUSP00000086565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089162] [ENSMUST00000204804]
Predicted Effect probably benign
Transcript: ENSMUST00000089162
AA Change: F593S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086565
Gene: ENSMUSG00000030104
AA Change: F593S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 581 1.1e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204524
Predicted Effect probably benign
Transcript: ENSMUST00000204804
SMART Domains Protein: ENSMUSP00000144901
Gene: ENSMUSG00000030104

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 529 9.9e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Edem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Edem1 APN 6 108855559 utr 3 prime probably benign
IGL00648:Edem1 APN 6 108851207 splice site probably null
IGL00694:Edem1 APN 6 108841601 missense possibly damaging 0.95
IGL02231:Edem1 APN 6 108828888 missense probably benign 0.06
IGL02967:Edem1 APN 6 108836777 missense probably damaging 1.00
IGL03018:Edem1 APN 6 108829142 missense probably damaging 0.98
PIT4468001:Edem1 UTSW 6 108844867 missense probably damaging 0.98
R0050:Edem1 UTSW 6 108828848 missense possibly damaging 0.91
R0367:Edem1 UTSW 6 108846752 missense probably damaging 1.00
R1165:Edem1 UTSW 6 108851253 missense probably damaging 1.00
R1354:Edem1 UTSW 6 108854316 missense possibly damaging 0.93
R1385:Edem1 UTSW 6 108846684 missense probably damaging 1.00
R1588:Edem1 UTSW 6 108841679 missense probably damaging 1.00
R1964:Edem1 UTSW 6 108844947 missense probably benign 0.03
R2060:Edem1 UTSW 6 108854287 missense probably damaging 0.99
R2106:Edem1 UTSW 6 108848725 missense probably damaging 0.98
R2393:Edem1 UTSW 6 108852543 missense probably damaging 1.00
R2443:Edem1 UTSW 6 108851269 missense probably benign 0.13
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3733:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3734:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R4754:Edem1 UTSW 6 108841697 missense probably damaging 1.00
R4791:Edem1 UTSW 6 108841634 missense probably damaging 1.00
R4792:Edem1 UTSW 6 108828746 unclassified probably benign
R5326:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5334:Edem1 UTSW 6 108848832 critical splice donor site probably null
R5501:Edem1 UTSW 6 108843100 critical splice donor site probably null
R5542:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5976:Edem1 UTSW 6 108842962 missense probably damaging 0.99
R6177:Edem1 UTSW 6 108851198 splice site probably null
R6835:Edem1 UTSW 6 108854399 missense probably benign 0.00
R7192:Edem1 UTSW 6 108829004 missense probably benign 0.00
R7239:Edem1 UTSW 6 108854380 missense probably benign
R7442:Edem1 UTSW 6 108851305 nonsense probably null
R7780:Edem1 UTSW 6 108841628 missense probably benign 0.00
R7902:Edem1 UTSW 6 108854377 missense possibly damaging 0.88
R8103:Edem1 UTSW 6 108852563 missense probably damaging 1.00
R8135:Edem1 UTSW 6 108829061 nonsense probably null
R8359:Edem1 UTSW 6 108846813 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GACTTAGTAGAGCTGTATGCCAG -3'
(R):5'- TGATGTGCCTATACTGCTGC -3'

Sequencing Primer
(F):5'- TTCATGCAGTGGCTAGCCTAGAAC -3'
(R):5'- GAGTATGCCACCTACTTCATGTGAG -3'
Posted On2018-06-06