Incidental Mutation 'R6556:Dennd5b'
ID522160
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene NameDENN/MADD domain containing 5B
Synonyms9330160C06Rik, D030011O10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location148988071-149101680 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 149014251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
Predicted Effect probably null
Transcript: ENSMUST00000111557
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150436
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 149027330 missense probably damaging 1.00
IGL00590:Dennd5b APN 6 149068308 missense probably benign 0.03
IGL00727:Dennd5b APN 6 149006716 splice site probably benign
IGL00838:Dennd5b APN 6 149005363 splice site probably benign
IGL01115:Dennd5b APN 6 149009748 splice site probably benign
IGL01150:Dennd5b APN 6 149068085 missense probably benign 0.01
IGL01873:Dennd5b APN 6 149044529 missense probably benign
IGL01991:Dennd5b APN 6 149080824 missense probably damaging 1.00
IGL02226:Dennd5b APN 6 149033301 missense probably benign 0.00
IGL02820:Dennd5b APN 6 149019342 missense probably null 0.51
IGL03056:Dennd5b APN 6 149055072 missense probably damaging 1.00
IGL03085:Dennd5b APN 6 149027395 missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148998260 missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148993759 missense probably benign 0.13
R0617:Dennd5b UTSW 6 149033262 splice site probably benign
R1241:Dennd5b UTSW 6 149068490 missense probably benign 0.06
R1252:Dennd5b UTSW 6 149044487 missense probably damaging 1.00
R1255:Dennd5b UTSW 6 149041650 missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 149068205 missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148998284 missense probably damaging 1.00
R1781:Dennd5b UTSW 6 149027398 missense probably damaging 1.00
R1861:Dennd5b UTSW 6 149068262 missense probably damaging 1.00
R1907:Dennd5b UTSW 6 149041576 missense probably benign 0.00
R2412:Dennd5b UTSW 6 149005238 missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149101217 missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 149044836 missense probably benign
R4581:Dennd5b UTSW 6 149016984 splice site silent
R4654:Dennd5b UTSW 6 149006837 missense probably damaging 1.00
R4725:Dennd5b UTSW 6 149044779 missense probably damaging 0.97
R4981:Dennd5b UTSW 6 149009772 missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 149041500 intron probably null
R5400:Dennd5b UTSW 6 149000016 missense probably damaging 1.00
R5452:Dennd5b UTSW 6 149041513 splice site probably null
R5548:Dennd5b UTSW 6 149019349 synonymous probably null
R5841:Dennd5b UTSW 6 149044755 missense probably benign 0.11
R5996:Dennd5b UTSW 6 149068095 missense probably benign 0.22
R6082:Dennd5b UTSW 6 149068695 missense probably damaging 0.99
R6812:Dennd5b UTSW 6 149081132 start gained probably benign
R6828:Dennd5b UTSW 6 148993746 missense probably damaging 0.99
R7104:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7231:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7325:Dennd5b UTSW 6 149020570 missense probably benign 0.00
R7399:Dennd5b UTSW 6 149036483 missense probably damaging 1.00
R7516:Dennd5b UTSW 6 149068380 missense probably benign 0.02
R7751:Dennd5b UTSW 6 149017106 missense probably benign 0.01
R7763:Dennd5b UTSW 6 149068658 missense probably damaging 1.00
R7770:Dennd5b UTSW 6 149041716 missense probably damaging 0.99
R7788:Dennd5b UTSW 6 149068566 missense probably benign 0.00
R7854:Dennd5b UTSW 6 149068466 missense probably benign 0.00
R7899:Dennd5b UTSW 6 149041661 missense probably damaging 1.00
R8328:Dennd5b UTSW 6 149020617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCTGCTCATCTGAAAAC -3'
(R):5'- TGAACCAACTCACTAGTTCAAGAGG -3'

Sequencing Primer
(F):5'- GCCTGCTCATCTGAAAACTGTTTAC -3'
(R):5'- TACAGATCGTTGTGAGCCAC -3'
Posted On2018-06-06