Incidental Mutation 'R6529:Fam92a'
ID522161
Institutional Source Beutler Lab
Gene Symbol Fam92a
Ensembl Gene ENSMUSG00000028218
Gene Namefamily with sequence similarity 92, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location12153409-12172015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12168978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000135961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087052] [ENSMUST00000108285] [ENSMUST00000177837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087052
AA Change: V175A

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084284
Gene: ENSMUSG00000028218
AA Change: V175A

DomainStartEndE-ValueType
Pfam:FAM92 70 284 2.2e-118 PFAM
low complexity region 333 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108285
AA Change: V175A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103920
Gene: ENSMUSG00000028218
AA Change: V175A

DomainStartEndE-ValueType
Pfam:FAM92 70 288 4.9e-127 PFAM
low complexity region 337 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126012
SMART Domains Protein: ENSMUSP00000133923
Gene: ENSMUSG00000028218

DomainStartEndE-ValueType
Pfam:FAM92 51 139 6.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152219
Predicted Effect unknown
Transcript: ENSMUST00000154416
AA Change: V87A
SMART Domains Protein: ENSMUSP00000120369
Gene: ENSMUSG00000028218
AA Change: V87A

DomainStartEndE-ValueType
Pfam:FAM92 1 197 7.5e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177837
AA Change: V175A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135961
Gene: ENSMUSG00000028218
AA Change: V175A

DomainStartEndE-ValueType
Pfam:FAM92 70 288 4.2e-109 PFAM
low complexity region 337 354 N/A INTRINSIC
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Fam92a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Fam92a APN 4 12164080 splice site probably benign
R0558:Fam92a UTSW 4 12164095 missense probably damaging 0.99
R0616:Fam92a UTSW 4 12168234 nonsense probably null
R1581:Fam92a UTSW 4 12155745 synonymous probably null
R1862:Fam92a UTSW 4 12155717 missense possibly damaging 0.70
R2027:Fam92a UTSW 4 12171216 missense probably damaging 1.00
R2185:Fam92a UTSW 4 12169041 splice site probably benign
R2212:Fam92a UTSW 4 12171696 critical splice donor site probably null
R3053:Fam92a UTSW 4 12157767 splice site probably null
R4441:Fam92a UTSW 4 12157733 missense probably damaging 1.00
R4771:Fam92a UTSW 4 12155689 missense probably benign 0.03
R5290:Fam92a UTSW 4 12171195 missense probably benign 0.08
R5928:Fam92a UTSW 4 12171919 unclassified probably benign
R6909:Fam92a UTSW 4 12168309 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGCAAGCTTGGTAAGAATGGTTC -3'
(R):5'- CTCCTTAAACCTCCTGAAAGCTG -3'

Sequencing Primer
(F):5'- GTTATGAAAAAGACAAAACCTC -3'
(R):5'- TCCTGAAAGCTGTAACTACACTG -3'
Posted On2018-06-06