Incidental Mutation 'R6556:Tnnt1'
ID522162
Institutional Source Beutler Lab
Gene Symbol Tnnt1
Ensembl Gene ENSMUSG00000064179
Gene Nametroponin T1, skeletal, slow
SynonymsssTnT, sTnT, Tnt, skeletal muscle slow-twitch TnT
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4504570-4516382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4509577 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 110 (E110G)
Ref Sequence ENSEMBL: ENSMUSP00000125795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071798] [ENSMUST00000108587] [ENSMUST00000163538] [ENSMUST00000163560] [ENSMUST00000163710] [ENSMUST00000163722] [ENSMUST00000166161] [ENSMUST00000166268] [ENSMUST00000166959] [ENSMUST00000178163]
Predicted Effect probably damaging
Transcript: ENSMUST00000071798
AA Change: E122G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071704
Gene: ENSMUSG00000064179
AA Change: E122G

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000086502
Predicted Effect probably damaging
Transcript: ENSMUST00000108587
AA Change: E123G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104228
Gene: ENSMUSG00000064179
AA Change: E123G

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 205 3e-36 PFAM
Pfam:Troponin 197 260 4.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163538
AA Change: E122G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127964
Gene: ENSMUSG00000064179
AA Change: E122G

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 160 4.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163560
Predicted Effect probably damaging
Transcript: ENSMUST00000163710
AA Change: E111G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129626
Gene: ENSMUSG00000064179
AA Change: E111G

DomainStartEndE-ValueType
coiled coil region 2 29 N/A INTRINSIC
Pfam:Troponin 57 199 1.9e-39 PFAM
low complexity region 235 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163722
SMART Domains Protein: ENSMUSP00000129409
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 17 64 N/A INTRINSIC
Pfam:Troponin 76 118 1.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166161
AA Change: E110G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125795
Gene: ENSMUSG00000064179
AA Change: E110G

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Troponin 56 198 3.4e-40 PFAM
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166268
AA Change: E112G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128476
Gene: ENSMUSG00000064179
AA Change: E112G

DomainStartEndE-ValueType
coiled coil region 2 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.6e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166959
AA Change: E123G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129109
Gene: ENSMUSG00000064179
AA Change: E123G

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 192 1.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169571
Predicted Effect probably damaging
Transcript: ENSMUST00000178163
AA Change: E122G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137198
Gene: ENSMUSG00000064179
AA Change: E122G

DomainStartEndE-ValueType
low complexity region 5 40 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a null or hypomorphic allele show small and loss of type I slow skeletal muscle fibers with compensatory hypertrophy of type II fast fibers and reduced contractile force and tolerance of skeletal muscle fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Tnnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Tnnt1 APN 7 4507550 missense possibly damaging 0.96
IGL01391:Tnnt1 APN 7 4514212 critical splice donor site probably null
IGL01582:Tnnt1 APN 7 4509983 missense probably damaging 1.00
R0098:Tnnt1 UTSW 7 4509045 missense probably damaging 0.99
R0963:Tnnt1 UTSW 7 4507595 missense probably damaging 1.00
R1489:Tnnt1 UTSW 7 4507525 nonsense probably null
R2340:Tnnt1 UTSW 7 4513616 splice site probably benign
R4224:Tnnt1 UTSW 7 4510007 missense probably damaging 1.00
R4624:Tnnt1 UTSW 7 4512268 intron probably benign
R4969:Tnnt1 UTSW 7 4507574 missense probably damaging 1.00
R5245:Tnnt1 UTSW 7 4510067 missense probably damaging 1.00
R5822:Tnnt1 UTSW 7 4516346 nonsense probably null
R6520:Tnnt1 UTSW 7 4509061 nonsense probably null
R6573:Tnnt1 UTSW 7 4514334 splice site probably null
R6838:Tnnt1 UTSW 7 4507407 missense possibly damaging 0.94
R7318:Tnnt1 UTSW 7 4510548 intron probably null
R7889:Tnnt1 UTSW 7 4508583 missense probably damaging 1.00
X0010:Tnnt1 UTSW 7 4509971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAGTGAAGTTGGAGCCACG -3'
(R):5'- ACTCCAGTATCCATTTCTACCAGG -3'

Sequencing Primer
(F):5'- AGCAAAGCTCAGCCTTTGTG -3'
(R):5'- TACCATGAGTTCGAGAGACTGTC -3'
Posted On2018-06-06