Incidental Mutation 'R6556:Gtf2h1'
ID522164
Institutional Source Beutler Lab
Gene Symbol Gtf2h1
Ensembl Gene ENSMUSG00000006599
Gene Namegeneral transcription factor II H, polypeptide 1
Synonymsp62, 62kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location46796103-46823800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46808665 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 245 (C245S)
Ref Sequence ENSEMBL: ENSMUSP00000006774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006774] [ENSMUST00000107644] [ENSMUST00000128420] [ENSMUST00000165031]
Predicted Effect probably damaging
Transcript: ENSMUST00000006774
AA Change: C245S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006774
Gene: ENSMUSG00000006599
AA Change: C245S

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 9 81 6.8e-25 PFAM
BSD 99 154 8.89e-11 SMART
BSD 179 231 2.09e-16 SMART
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107644
AA Change: C251S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103271
Gene: ENSMUSG00000006599
AA Change: C251S

DomainStartEndE-ValueType
Pfam:PH_TFIIH 22 103 8.5e-29 PFAM
BSD 105 160 8.89e-11 SMART
BSD 185 237 2.09e-16 SMART
low complexity region 423 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128420
SMART Domains Protein: ENSMUSP00000120008
Gene: ENSMUSG00000006599

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 9 51 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144708
Predicted Effect probably benign
Transcript: ENSMUST00000165031
SMART Domains Protein: ENSMUSP00000129337
Gene: ENSMUSG00000006599

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 15 87 5.5e-26 PFAM
Pfam:BSD 104 144 8.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Gtf2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Gtf2h1 APN 7 46819210 missense possibly damaging 0.90
IGL01108:Gtf2h1 APN 7 46812498 missense probably damaging 1.00
IGL02054:Gtf2h1 APN 7 46815425 splice site probably benign
IGL02075:Gtf2h1 APN 7 46801741 missense probably damaging 1.00
IGL02309:Gtf2h1 APN 7 46816388 missense probably damaging 0.99
IGL02423:Gtf2h1 APN 7 46815400 missense probably benign
IGL02481:Gtf2h1 APN 7 46804993 missense probably damaging 1.00
IGL03159:Gtf2h1 APN 7 46806743 missense possibly damaging 0.80
R0136:Gtf2h1 UTSW 7 46815416 missense possibly damaging 0.49
R1073:Gtf2h1 UTSW 7 46816944 missense probably damaging 1.00
R1242:Gtf2h1 UTSW 7 46812751 critical splice donor site probably null
R1469:Gtf2h1 UTSW 7 46805125 critical splice donor site probably null
R1469:Gtf2h1 UTSW 7 46805125 critical splice donor site probably null
R1740:Gtf2h1 UTSW 7 46812466 missense probably null
R2192:Gtf2h1 UTSW 7 46815323 missense possibly damaging 0.73
R3012:Gtf2h1 UTSW 7 46803895 missense probably damaging 1.00
R4238:Gtf2h1 UTSW 7 46805065 missense probably benign
R4239:Gtf2h1 UTSW 7 46805065 missense probably benign
R4715:Gtf2h1 UTSW 7 46815412 missense possibly damaging 0.66
R4776:Gtf2h1 UTSW 7 46822878 nonsense probably null
R6193:Gtf2h1 UTSW 7 46806830 critical splice donor site probably null
R6338:Gtf2h1 UTSW 7 46816456 missense probably benign
R7102:Gtf2h1 UTSW 7 46819126 missense probably benign 0.21
R8232:Gtf2h1 UTSW 7 46801679 missense probably benign 0.02
R8273:Gtf2h1 UTSW 7 46805050 missense probably benign 0.00
RF021:Gtf2h1 UTSW 7 46803865 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGTTCTTAAGAGCTAGGAACTCAC -3'
(R):5'- TCTAATGGCTTATCTTCCAACGATGTC -3'

Sequencing Primer
(F):5'- AAGAGCTAGGAACTCACTCTATAAG -3'
(R):5'- CCAACGATGTCAAATCTAGCATTGGG -3'
Posted On2018-06-06