Mutagenetix > Incidental Mutations

Incidental Mutation 'R6529:Fbxo2'

522165

Institutional Source

Beutler Lab

Gene Symbol

Fbxo2

Ensembl Gene

ENSMUSG00000041556

Gene Name

F-box protein 2

Synonyms

Prpl4, Fbs1, NFB42, FBX2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.343) question?

Stock #

R6529 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

148160621-148166424 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 148165054 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 187 (D187V)

Ref Sequence

ENSEMBL: ENSMUSP00000037377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047951] [ENSMUST00000057907] [ENSMUST00000129253] [ENSMUST00000173352]

PDB Structure

Structural basis of sugar-recognizing ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis of sugar-recognizing ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of the Sugar Recognizing SCF Ubiquitin Ligase at 1.7 Resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047951
AA Change: D187V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037377
Gene: ENSMUSG00000041556
AA Change: D187V

Domain	Start	End	E-Value	Type
Pfam:F-box	50	97	3.8e-9	PFAM
Pfam:F-box-like	51	97	9.3e-8	PFAM
FBA	114	297	3.81e-104	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000057907

SMART Domains

Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

Domain	Start	End	E-Value	Type
FBOX	9	50	1.37e-2	SMART
FBA	68	252	2.24e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129253

SMART Domains

Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

Domain	Start	End	E-Value	Type
FBOX	9	50	1.37e-2	SMART
FBA	68	213	1.15e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173352

SMART Domains

Protein: ENSMUSP00000134624
Gene: ENSMUSG00000029001

Domain	Start	End	E-Value	Type
FBOX	62	103	1.37e-2	SMART
FBA	121	254	3.86e-50	SMART

Meta Mutation Damage Score

0.7626

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is highly similar to the rat NFB42 (neural F Box 42 kDa) protein which is enriched in the nervous system and may play a role in maintaining neurons in a postmitotic state. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are behaviorally normal but display accelerated, age-related hearing loss associated with cochlear degeneration. Cellular degeneration begins at 2 months in the supporting cells of the organ of Corti and progresses to cochlear hair cells and the spiral ganglion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	T	7: 79,089,731	M296L	probably benign	Het
Atxn2	T	C	5: 121,811,614		probably null	Het
B3galnt2	G	T	13: 13,995,792	R242S	probably benign	Het
Casz1	G	A	4: 148,938,189	E571K	probably damaging	Het
Ccdc163	A	G	4: 116,708,924		probably null	Het
Cd109	A	G	9: 78,712,625	D1383G	probably damaging	Het
Cd200r1	A	G	16: 44,789,702	T95A	possibly damaging	Het
Chd2	T	C	7: 73,503,443	E219G	possibly damaging	Het
Dnah14	T	A	1: 181,666,469	V1730D	probably damaging	Het
Eps8	G	A	6: 137,514,337	H348Y	possibly damaging	Het
Fam92a	A	G	4: 12,168,978	V175A	probably damaging	Het
Fsip2	A	T	2: 82,982,313	Y2992F	probably benign	Het
Gle1	A	T	2: 29,935,527	T10S	possibly damaging	Het
Got2	T	C	8: 95,888,385		probably benign	Het
Gtf3c6	T	C	10: 40,251,255	T34A	probably benign	Het
Hist1h4j	G	T	13: 21,735,306	V71F	possibly damaging	Het
Klf15	C	T	6: 90,467,412	T323I	probably damaging	Het
Krtap5-3	C	A	7: 142,202,342	C305*	probably null	Het
Map2k6	A	T	11: 110,492,562	D99V	probably damaging	Het
Nckap5l	G	T	15: 99,426,594	P676Q	probably benign	Het
Nup188	A	T	2: 30,326,454	T757S	possibly damaging	Het
Olfr1337	C	T	4: 118,781,710	V292I	probably benign	Het
Olfr638	T	C	7: 104,003,926	V217A	probably benign	Het
Peg3	C	A	7: 6,708,072	A1384S	probably damaging	Het
Plekho2	C	T	9: 65,573,101	R14H	probably benign	Het
Qsox2	A	T	2: 26,217,741	C247S	probably damaging	Het
Slc25a13	A	G	6: 6,073,451	V469A	probably benign	Het
Slitrk3	T	C	3: 73,051,218	T74A	probably benign	Het
Spata48	T	C	11: 11,515,009	F120S	possibly damaging	Het
Sult1a1	T	C	7: 126,675,138	T91A	probably benign	Het
Sult3a2	T	C	10: 33,779,737	Y82C	probably damaging	Het
Taf1b	A	T	12: 24,556,651	H490L	possibly damaging	Het
Trrap	T	A	5: 144,834,204	H2804Q	probably benign	Het
Uhrf1bp1	A	G	17: 27,879,776	I218M	possibly damaging	Het
Usp8	A	G	2: 126,725,378	I106V	probably benign	Het
Wdcp	T	A	12: 4,851,143	V333D	probably damaging	Het
Wdr46	T	A	17: 33,949,146	L564Q	possibly damaging	Het
Wrn	T	C	8: 33,335,976		probably null	Het
Zfp664	C	T	5: 124,886,288	H249Y	probably damaging	Het
Zfp975	A	C	7: 42,661,901	H429Q	possibly damaging	Het

Other mutations in Fbxo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01286:Fbxo2	APN	4	148165706	missense	probably benign	0.01
IGL01690:Fbxo2	APN	4	148165124	critical splice donor site	probably null
R0085:Fbxo2	UTSW	4	148164910	unclassified	probably null
R1083:Fbxo2	UTSW	4	148165777	splice site	probably null
R2879:Fbxo2	UTSW	4	148166011	missense	probably damaging	1.00
R4583:Fbxo2	UTSW	4	148164899	missense	possibly damaging	0.54
R5108:Fbxo2	UTSW	4	148166029	missense	probably damaging	1.00
R6715:Fbxo2	UTSW	4	148165769	missense	probably benign	0.00
R7772:Fbxo2	UTSW	4	148164326	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCTGTCTTATCCCTACAGAG -3'
(R):5'- AGCTTTCCACCAGTTGCCAAC -3'

Sequencing Primer
(F):5'- CTACAGAGGACTTGGAGGGCTG -3'
(R):5'- AGTTGCCAACCCTTGCG -3'

Posted On

2018-06-06