Incidental Mutation 'R6529:Fbxo2'
ID522165
Institutional Source Beutler Lab
Gene Symbol Fbxo2
Ensembl Gene ENSMUSG00000041556
Gene NameF-box protein 2
SynonymsPrpl4, Fbs1, NFB42, FBX2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148160621-148166424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148165054 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 187 (D187V)
Ref Sequence ENSEMBL: ENSMUSP00000037377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047951] [ENSMUST00000057907] [ENSMUST00000129253] [ENSMUST00000173352]
PDB Structure
Structural basis of sugar-recognizing ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis of sugar-recognizing ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of the Sugar Recognizing SCF Ubiquitin Ligase at 1.7 Resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000047951
AA Change: D187V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037377
Gene: ENSMUSG00000041556
AA Change: D187V

DomainStartEndE-ValueType
Pfam:F-box 50 97 3.8e-9 PFAM
Pfam:F-box-like 51 97 9.3e-8 PFAM
FBA 114 297 3.81e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057907
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129253
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173352
SMART Domains Protein: ENSMUSP00000134624
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 62 103 1.37e-2 SMART
FBA 121 254 3.86e-50 SMART
Meta Mutation Damage Score 0.7626 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is highly similar to the rat NFB42 (neural F Box 42 kDa) protein which is enriched in the nervous system and may play a role in maintaining neurons in a postmitotic state. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are behaviorally normal but display accelerated, age-related hearing loss associated with cochlear degeneration. Cellular degeneration begins at 2 months in the supporting cells of the organ of Corti and progresses to cochlear hair cells and the spiral ganglion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Fbxo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Fbxo2 APN 4 148165706 missense probably benign 0.01
IGL01690:Fbxo2 APN 4 148165124 critical splice donor site probably null
R0085:Fbxo2 UTSW 4 148164910 unclassified probably null
R1083:Fbxo2 UTSW 4 148165777 splice site probably null
R2879:Fbxo2 UTSW 4 148166011 missense probably damaging 1.00
R4583:Fbxo2 UTSW 4 148164899 missense possibly damaging 0.54
R5108:Fbxo2 UTSW 4 148166029 missense probably damaging 1.00
R6715:Fbxo2 UTSW 4 148165769 missense probably benign 0.00
R7772:Fbxo2 UTSW 4 148164326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTGTCTTATCCCTACAGAG -3'
(R):5'- AGCTTTCCACCAGTTGCCAAC -3'

Sequencing Primer
(F):5'- CTACAGAGGACTTGGAGGGCTG -3'
(R):5'- AGTTGCCAACCCTTGCG -3'
Posted On2018-06-06