Mutagenetix > Incidental Mutation

Incidental Mutation 'R6556:Atp2a1'

522166

Institutional Source

Beutler Lab

Gene Symbol

Atp2a1

Ensembl Gene

ENSMUSG00000030730

Gene Name

ATPase, Ca++ transporting, cardiac muscle, fast twitch 1

Synonyms

SERCA1

Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6556 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126445858-126463108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 126450262 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 536 (P536Q)

Ref Sequence

ENSEMBL: ENSMUSP00000032974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000106405] [ENSMUST00000106407]

AlphaFold

Q8R429

Predicted Effect

probably benign
Transcript: ENSMUST00000032974
AA Change: P536Q

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730
AA Change: P536Q

Domain	Start	End	E-Value	Type
Cation_ATPase_N	3	77	4.39e-16	SMART
Pfam:E1-E2_ATPase	92	340	1.5e-66	PFAM
Pfam:Hydrolase	345	715	7.5e-20	PFAM
Pfam:HAD	348	712	1.2e-18	PFAM
Pfam:Cation_ATPase	418	528	3.2e-23	PFAM
Pfam:Hydrolase_3	683	747	2.3e-7	PFAM
Pfam:Cation_ATPase_C	784	987	4.8e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106405

SMART Domains

Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727

Domain	Start	End	E-Value	Type
Pfam:Rabaptin	2	107	1.4e-41	PFAM
low complexity region	139	158	N/A	INTRINSIC
low complexity region	175	194	N/A	INTRINSIC
Pfam:Rabaptin	196	311	5.9e-10	PFAM
Pfam:Rab5-bind	289	456	4.6e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106407

SMART Domains

Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727

Domain	Start	End	E-Value	Type
Pfam:Rabaptin	13	171	1.4e-39	PFAM
low complexity region	182	201	N/A	INTRINSIC
low complexity region	218	237	N/A	INTRINSIC
Pfam:Rab5-bind	274	487	4.1e-21	PFAM
Pfam:Rab5-bind	469	531	1.6e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133300

Predicted Effect

probably benign
Transcript: ENSMUST00000146973

SMART Domains

Protein: ENSMUSP00000119018
Gene: ENSMUSG00000030730

Domain	Start	End	E-Value	Type
Pfam:Cation_ATPase_C	6	132	6.3e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151304

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

MGI Phenotype

Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029P11Rik	A	G	15: 81,980,738	D60G	probably damaging	Het
2310035C23Rik	T	A	1: 105,726,440	F845I	probably damaging	Het
4930539E08Rik	T	A	17: 28,904,611	D114V	probably damaging	Het
AF366264	G	A	8: 13,837,690	Q134*	probably null	Het
Cabyr	T	A	18: 12,751,016	S187T	probably benign	Het
Camkk1	A	T	11: 73,033,870	N303I	probably benign	Het
Cdh13	C	T	8: 118,968,187	P259S	probably damaging	Het
Csnk1g3	A	G	18: 53,930,282	D255G	possibly damaging	Het
Dennd5b	A	C	6: 149,014,251		probably null	Het
Dnajc14	A	G	10: 128,814,631	D528G	probably benign	Het
Edem1	T	C	6: 108,854,357	F593S	probably benign	Het
Erbb2	G	A	11: 98,436,082	D1106N	possibly damaging	Het
Ermp1	T	C	19: 29,612,921	M794V	possibly damaging	Het
Fam208a	T	G	14: 27,429,258	Y64D	probably benign	Het
Fam214b	C	T	4: 43,033,896	R460H	probably damaging	Het
Fip1l1	T	A	5: 74,547,177		probably null	Het
Gm11639	A	G	11: 105,008,251	N4343S	probably null	Het
Gm20730	C	T	6: 43,081,542	C112Y	probably damaging	Het
Gtf2h1	T	A	7: 46,808,665	C245S	probably damaging	Het
Hdhd5	T	C	6: 120,523,554	H61R	probably benign	Het
Ighv1-71	A	T	12: 115,742,472	V31E	probably damaging	Het
Igsf9b	T	C	9: 27,329,555	F688S	probably damaging	Het
Iqcd	T	C	5: 120,602,378	V258A	probably damaging	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Lpo	G	T	11: 87,817,763	Y136*	probably null	Het
Med30	A	G	15: 52,730,383		probably benign	Het
Mertk	T	A	2: 128,776,421	V524D	probably benign	Het
Olfr1156	T	C	2: 87,949,976	I86V	probably benign	Het
Olfr1261	T	A	2: 89,994,173	F260Y	probably benign	Het
Olfr1263	T	C	2: 90,015,094	Y55H	probably damaging	Het
Pde6b	T	A	5: 108,421,501	M358K	possibly damaging	Het
Prep	GA	G	10: 45,158,314		probably null	Het
Prpf4b	G	A	13: 34,896,032	R793Q	probably damaging	Het
Rela	T	A	19: 5,647,338	N524K	probably damaging	Het
Rnaset2a	T	C	17: 8,141,648	D74G	probably damaging	Het
Serinc2	T	A	4: 130,258,271	I267F	probably damaging	Het
Sesn3	T	C	9: 14,321,253	F274S	possibly damaging	Het
Spag1	T	C	15: 36,195,407	Y249H	probably damaging	Het
Sstr1	A	T	12: 58,213,692	D367V	possibly damaging	Het
Tnnt1	T	C	7: 4,509,577	E110G	probably damaging	Het
Tpm1	T	A	9: 67,028,169		probably null	Het
Unc93b1	T	C	19: 3,944,105	V412A	probably benign	Het
Uox	G	C	3: 146,624,648		probably null	Het
Usp44	T	C	10: 93,846,008	Y107H	probably benign	Het

Other mutations in Atp2a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Atp2a1	APN	7	126447216	nonsense	probably null
IGL00474:Atp2a1	APN	7	126450294	nonsense	probably null
IGL00500:Atp2a1	APN	7	126447216	nonsense	probably null
IGL01112:Atp2a1	APN	7	126450307	missense	probably benign	0.13
IGL01380:Atp2a1	APN	7	126448770	missense	possibly damaging	0.84
IGL01503:Atp2a1	APN	7	126448578	missense	probably damaging	1.00
IGL01630:Atp2a1	APN	7	126450265	missense	probably benign	0.00
IGL01679:Atp2a1	APN	7	126456809	missense	probably benign	0.00
IGL01729:Atp2a1	APN	7	126457934	missense	probably damaging	0.99
IGL02290:Atp2a1	APN	7	126452649	splice site	probably benign
IGL02929:Atp2a1	APN	7	126456944	missense	probably damaging	1.00
IGL02951:Atp2a1	APN	7	126450227	missense	possibly damaging	0.58
IGL03249:Atp2a1	APN	7	126462805	missense	probably benign	0.12
1mM(1):Atp2a1	UTSW	7	126446909	missense	probably damaging	1.00
R0052:Atp2a1	UTSW	7	126457897	splice site	probably benign
R0052:Atp2a1	UTSW	7	126457897	splice site	probably benign
R0070:Atp2a1	UTSW	7	126447452	missense	probably benign	0.03
R0070:Atp2a1	UTSW	7	126447452	missense	probably benign	0.03
R0121:Atp2a1	UTSW	7	126457944	missense	probably damaging	1.00
R0398:Atp2a1	UTSW	7	126450418	unclassified	probably benign
R0578:Atp2a1	UTSW	7	126450143	missense	probably benign
R0626:Atp2a1	UTSW	7	126446990	critical splice acceptor site	probably null
R0739:Atp2a1	UTSW	7	126448256	missense	possibly damaging	0.87
R1558:Atp2a1	UTSW	7	126452672	missense	possibly damaging	0.88
R1700:Atp2a1	UTSW	7	126462909	missense	probably damaging	1.00
R1748:Atp2a1	UTSW	7	126459608	missense	possibly damaging	0.67
R1799:Atp2a1	UTSW	7	126450142	missense	probably benign	0.27
R1808:Atp2a1	UTSW	7	126453401	missense	probably damaging	0.97
R2058:Atp2a1	UTSW	7	126447672	missense	possibly damaging	0.60
R2143:Atp2a1	UTSW	7	126448725	nonsense	probably null
R2427:Atp2a1	UTSW	7	126446583	makesense	probably null
R3113:Atp2a1	UTSW	7	126448369	missense	probably damaging	1.00
R4501:Atp2a1	UTSW	7	126453383	missense	probably benign	0.00
R4604:Atp2a1	UTSW	7	126448623	missense	probably damaging	0.96
R4934:Atp2a1	UTSW	7	126453428	missense	probably benign
R4939:Atp2a1	UTSW	7	126450116	missense	probably benign
R5646:Atp2a1	UTSW	7	126453105	missense	probably benign
R6093:Atp2a1	UTSW	7	126446921	missense	probably damaging	1.00
R6908:Atp2a1	UTSW	7	126448535	critical splice donor site	probably null
R6911:Atp2a1	UTSW	7	126456836	missense	probably damaging	1.00
R7206:Atp2a1	UTSW	7	126447972	missense	probably benign	0.01
R7354:Atp2a1	UTSW	7	126448856	missense	probably damaging	1.00
R7363:Atp2a1	UTSW	7	126462889	missense	possibly damaging	0.88
R7501:Atp2a1	UTSW	7	126450172	missense	probably benign	0.29
R7560:Atp2a1	UTSW	7	126459656	missense	possibly damaging	0.95
R7716:Atp2a1	UTSW	7	126462187	missense	possibly damaging	0.86
R7772:Atp2a1	UTSW	7	126448535	critical splice donor site	probably null
R8039:Atp2a1	UTSW	7	126448805	missense	probably damaging	0.99
R8391:Atp2a1	UTSW	7	126448716	missense	possibly damaging	0.94
R8478:Atp2a1	UTSW	7	126448330	missense	probably damaging	1.00
R9020:Atp2a1	UTSW	7	126446963	missense	probably benign
X0022:Atp2a1	UTSW	7	126448250	missense	possibly damaging	0.49
X0060:Atp2a1	UTSW	7	126462882	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CACTGGGGAAAACTGTCTCAAC -3'
(R):5'- CCGTGGGCAACAAGATGTTTG -3'

Sequencing Primer
(F):5'- GGGGAAAACTGTCTCAACACAAGTC -3'
(R):5'- CAAGATGTTTGTCAAGGTCAGGATC -3'

Posted On

2018-06-06