Incidental Mutation 'R6529:Atxn2'
ID 522169
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 044655-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R6529 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121949677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000086310] [ENSMUST00000136960] [ENSMUST00000160220] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086310
SMART Domains Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136960
SMART Domains Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2.4e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect probably benign
Transcript: ENSMUST00000160220
SMART Domains Protein: ENSMUSP00000124059
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161433
Predicted Effect probably benign
Transcript: ENSMUST00000198161
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 78,739,479 (GRCm39) M296L probably benign Het
B3galnt2 G T 13: 14,170,377 (GRCm39) R242S probably benign Het
Bltp3a A G 17: 28,098,750 (GRCm39) I218M possibly damaging Het
Casz1 G A 4: 149,022,646 (GRCm39) E571K probably damaging Het
Ccdc163 A G 4: 116,566,121 (GRCm39) probably null Het
Cd109 A G 9: 78,619,907 (GRCm39) D1383G probably damaging Het
Cd200r1 A G 16: 44,610,065 (GRCm39) T95A possibly damaging Het
Chd2 T C 7: 73,153,191 (GRCm39) E219G possibly damaging Het
Cibar1 A G 4: 12,168,978 (GRCm39) V175A probably damaging Het
Dnah14 T A 1: 181,494,034 (GRCm39) V1730D probably damaging Het
Eps8 G A 6: 137,491,335 (GRCm39) H348Y possibly damaging Het
Fbxo2 A T 4: 148,249,511 (GRCm39) D187V probably damaging Het
Fsip2 A T 2: 82,812,657 (GRCm39) Y2992F probably benign Het
Gle1 A T 2: 29,825,539 (GRCm39) T10S possibly damaging Het
Got2 T C 8: 96,615,013 (GRCm39) probably benign Het
Gtf3c6 T C 10: 40,127,251 (GRCm39) T34A probably benign Het
H4c11 G T 13: 21,919,476 (GRCm39) V71F possibly damaging Het
Klf15 C T 6: 90,444,394 (GRCm39) T323I probably damaging Het
Krtap5-3 C A 7: 141,756,079 (GRCm39) C305* probably null Het
Map2k6 A T 11: 110,383,388 (GRCm39) D99V probably damaging Het
Nckap5l G T 15: 99,324,475 (GRCm39) P676Q probably benign Het
Nup188 A T 2: 30,216,466 (GRCm39) T757S possibly damaging Het
Or10ak13 C T 4: 118,638,907 (GRCm39) V292I probably benign Het
Or51q1c T C 7: 103,653,133 (GRCm39) V217A probably benign Het
Peg3 C A 7: 6,711,071 (GRCm39) A1384S probably damaging Het
Plekho2 C T 9: 65,480,383 (GRCm39) R14H probably benign Het
Qsox2 A T 2: 26,107,753 (GRCm39) C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 (GRCm39) V469A probably benign Het
Slitrk3 T C 3: 72,958,551 (GRCm39) T74A probably benign Het
Spmip7 T C 11: 11,465,009 (GRCm39) F120S possibly damaging Het
Sult1a1 T C 7: 126,274,310 (GRCm39) T91A probably benign Het
Sult3a2 T C 10: 33,655,733 (GRCm39) Y82C probably damaging Het
Taf1b A T 12: 24,606,650 (GRCm39) H490L possibly damaging Het
Trrap T A 5: 144,771,014 (GRCm39) H2804Q probably benign Het
Usp8 A G 2: 126,567,298 (GRCm39) I106V probably benign Het
Wdcp T A 12: 4,901,143 (GRCm39) V333D probably damaging Het
Wdr46 T A 17: 34,168,120 (GRCm39) L564Q possibly damaging Het
Wrn T C 8: 33,826,004 (GRCm39) probably null Het
Zfp664 C T 5: 124,963,352 (GRCm39) H249Y probably damaging Het
Zfp975 A C 7: 42,311,325 (GRCm39) H429Q possibly damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGCCATTTATCATGCGGG -3'
(R):5'- AGGTCTCAGCTGGGAAATGC -3'

Sequencing Primer
(F):5'- CCATTTATCATGCGGGGCTGG -3'
(R):5'- TCTCAGCTGGGAAATGCTAAGTCAC -3'
Posted On 2018-06-06