Incidental Mutation 'R6529:Zfp664'
ID522171
Institutional Source Beutler Lab
Gene Symbol Zfp664
Ensembl Gene ENSMUSG00000079215
Gene Namezinc finger protein 664
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124862691-124902693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124886288 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 249 (H249Y)
Ref Sequence ENSEMBL: ENSMUSP00000107048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111417]
Predicted Effect probably damaging
Transcript: ENSMUST00000111417
AA Change: H249Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107048
Gene: ENSMUSG00000079215
AA Change: H249Y

DomainStartEndE-ValueType
ZnF_C2H2 3 25 2.57e-3 SMART
ZnF_C2H2 31 53 7.55e-1 SMART
ZnF_C2H2 59 81 5.99e-4 SMART
ZnF_C2H2 87 109 3.21e-4 SMART
ZnF_C2H2 115 137 4.54e-4 SMART
ZnF_C2H2 143 165 4.79e-3 SMART
ZnF_C2H2 171 193 8.34e-3 SMART
ZnF_C2H2 199 221 6.23e-2 SMART
ZnF_C2H2 227 249 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141533
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Zfp664
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01556:Zfp664 APN 5 124886188 nonsense probably null
IGL02683:Zfp664 APN 5 124886322 missense probably benign 0.03
R0394:Zfp664 UTSW 5 124886065 nonsense probably null
R0629:Zfp664 UTSW 5 124885595 missense probably damaging 0.99
R1400:Zfp664 UTSW 5 124886153 missense unknown
R6052:Zfp664 UTSW 5 124886186 missense unknown
R6058:Zfp664 UTSW 5 124885978 nonsense probably null
R7031:Zfp664 UTSW 5 124886006 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTGCATCCACCAGAGAGTG -3'
(R):5'- TCCATCCTGGGCAAATACAG -3'

Sequencing Primer
(F):5'- CACCAGAGAGTGCACACAGG -3'
(R):5'- TCCATCCTGGGCAAATACAGAGAAG -3'
Posted On2018-06-06