Mutagenetix > Incidental Mutations

Incidental Mutation 'R6556:Sesn3'

522172

Institutional Source

Beutler Lab

Gene Symbol

Sesn3

Ensembl Gene

ENSMUSG00000032009

Gene Name

sestrin 3

Synonyms

5630400E15Rik, SEST3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6556 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14275067-14333101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14321253 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 274 (F274S)

Ref Sequence

ENSEMBL: ENSMUSP00000146784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034507] [ENSMUST00000208222] [ENSMUST00000209187]

Predicted Effect

probably benign
Transcript: ENSMUST00000034507
AA Change: F335S

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000034507
Gene: ENSMUSG00000032009
AA Change: F335S

Domain	Start	End	E-Value	Type
low complexity region	6	12	N/A	INTRINSIC
Pfam:PA26	39	491	8.4e-204	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208142

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208222
AA Change: F413S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209106

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209145

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209187
AA Change: F274S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: When fed a high fat diet, mice homozygous for a gene trap allele exhibit impaired glucose tolerance, insulin resistance, reduced hepatic glucose production, impaired adipocyte glucose uptake, increased hepatic steatosis, and decreased mitochondria in the liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029P11Rik	A	G	15: 81,980,738	D60G	probably damaging	Het
2310035C23Rik	T	A	1: 105,726,440	F845I	probably damaging	Het
4930539E08Rik	T	A	17: 28,904,611	D114V	probably damaging	Het
AF366264	G	A	8: 13,837,690	Q134*	probably null	Het
Atp2a1	G	T	7: 126,450,262	P536Q	probably benign	Het
Cabyr	T	A	18: 12,751,016	S187T	probably benign	Het
Camkk1	A	T	11: 73,033,870	N303I	probably benign	Het
Cdh13	C	T	8: 118,968,187	P259S	probably damaging	Het
Csnk1g3	A	G	18: 53,930,282	D255G	possibly damaging	Het
Dennd5b	A	C	6: 149,014,251		probably null	Het
Dnajc14	A	G	10: 128,814,631	D528G	probably benign	Het
Edem1	T	C	6: 108,854,357	F593S	probably benign	Het
Erbb2	G	A	11: 98,436,082	D1106N	possibly damaging	Het
Ermp1	T	C	19: 29,612,921	M794V	possibly damaging	Het
Fam208a	T	G	14: 27,429,258	Y64D	probably benign	Het
Fam214b	C	T	4: 43,033,896	R460H	probably damaging	Het
Fip1l1	T	A	5: 74,547,177		probably null	Het
Gm11639	A	G	11: 105,008,251	N4343S	probably null	Het
Gm20730	C	T	6: 43,081,542	C112Y	probably damaging	Het
Gtf2h1	T	A	7: 46,808,665	C245S	probably damaging	Het
Hdhd5	T	C	6: 120,523,554	H61R	probably benign	Het
Ighv1-71	A	T	12: 115,742,472	V31E	probably damaging	Het
Igsf9b	T	C	9: 27,329,555	F688S	probably damaging	Het
Iqcd	T	C	5: 120,602,378	V258A	probably damaging	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Lpo	G	T	11: 87,817,763	Y136*	probably null	Het
Med30	A	G	15: 52,730,383		probably benign	Het
Mertk	T	A	2: 128,776,421	V524D	probably benign	Het
Olfr1156	T	C	2: 87,949,976	I86V	probably benign	Het
Olfr1261	T	A	2: 89,994,173	F260Y	probably benign	Het
Olfr1263	T	C	2: 90,015,094	Y55H	probably damaging	Het
Pde6b	T	A	5: 108,421,501	M358K	possibly damaging	Het
Prep	GA	G	10: 45,158,314		probably null	Het
Prpf4b	G	A	13: 34,896,032	R793Q	probably damaging	Het
Rela	T	A	19: 5,647,338	N524K	probably damaging	Het
Rnaset2a	T	C	17: 8,141,648	D74G	probably damaging	Het
Serinc2	T	A	4: 130,258,271	I267F	probably damaging	Het
Spag1	T	C	15: 36,195,407	Y249H	probably damaging	Het
Sstr1	A	T	12: 58,213,692	D367V	possibly damaging	Het
Tnnt1	T	C	7: 4,509,577	E110G	probably damaging	Het
Tpm1	T	A	9: 67,028,169		probably null	Het
Unc93b1	T	C	19: 3,944,105	V412A	probably benign	Het
Uox	G	C	3: 146,624,648		probably null	Het
Usp44	T	C	10: 93,846,008	Y107H	probably benign	Het

Other mutations in Sesn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00970:Sesn3	APN	9	14321142	missense	probably damaging	1.00
IGL01396:Sesn3	APN	9	14321078	missense	probably benign	0.43
IGL01925:Sesn3	APN	9	14320400	missense	probably damaging	1.00
IGL02016:Sesn3	APN	9	14320337	missense	probably damaging	1.00
IGL02498:Sesn3	APN	9	14306268	splice site	probably benign
IGL02892:Sesn3	APN	9	14314734	critical splice donor site	probably null
IGL02933:Sesn3	APN	9	14321208	missense	probably damaging	1.00
IGL03112:Sesn3	APN	9	14310261	missense	probably damaging	1.00
R0591:Sesn3	UTSW	9	14308558	missense	probably damaging	0.96
R1450:Sesn3	UTSW	9	14316224	missense	possibly damaging	0.80
R1495:Sesn3	UTSW	9	14308521	missense	probably damaging	0.98
R1897:Sesn3	UTSW	9	14308645	missense	probably damaging	1.00
R2237:Sesn3	UTSW	9	14308465	missense	probably benign
R2238:Sesn3	UTSW	9	14308465	missense	probably benign
R4209:Sesn3	UTSW	9	14306209	missense	probably benign	0.12
R4352:Sesn3	UTSW	9	14320373	missense	probably damaging	0.99
R4535:Sesn3	UTSW	9	14322658	missense	probably benign	0.05
R4572:Sesn3	UTSW	9	14321220	missense	probably benign	0.03
R6261:Sesn3	UTSW	9	14321163	missense	probably benign	0.27
R6304:Sesn3	UTSW	9	14322561	critical splice acceptor site	probably null
R6741:Sesn3	UTSW	9	14320340	missense	possibly damaging	0.72
R6906:Sesn3	UTSW	9	14325641	missense	probably damaging	0.98
R6988:Sesn3	UTSW	9	14310257	nonsense	probably null
R7289:Sesn3	UTSW	9	14276552	start codon destroyed	probably benign
R7318:Sesn3	UTSW	9	14308577	missense	probably damaging	0.96
R7646:Sesn3	UTSW	9	14308615	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACCATGGGTTCTCACTGG -3'
(R):5'- ATCATTCACTTTCATGGCCATG -3'

Sequencing Primer
(F):5'- ACCATGGGTTCTCACTGGTGAAC -3'
(R):5'- TAGCCCCAAACAGGCTAT -3'

Posted On

2018-06-06