Incidental Mutation 'R6556:Sesn3'
ID522172
Institutional Source Beutler Lab
Gene Symbol Sesn3
Ensembl Gene ENSMUSG00000032009
Gene Namesestrin 3
Synonyms5630400E15Rik, SEST3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location14275067-14333101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14321253 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 274 (F274S)
Ref Sequence ENSEMBL: ENSMUSP00000146784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034507] [ENSMUST00000208222] [ENSMUST00000209187]
Predicted Effect probably benign
Transcript: ENSMUST00000034507
AA Change: F335S

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034507
Gene: ENSMUSG00000032009
AA Change: F335S

DomainStartEndE-ValueType
low complexity region 6 12 N/A INTRINSIC
Pfam:PA26 39 491 8.4e-204 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208142
Predicted Effect possibly damaging
Transcript: ENSMUST00000208222
AA Change: F413S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209145
Predicted Effect possibly damaging
Transcript: ENSMUST00000209187
AA Change: F274S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: When fed a high fat diet, mice homozygous for a gene trap allele exhibit impaired glucose tolerance, insulin resistance, reduced hepatic glucose production, impaired adipocyte glucose uptake, increased hepatic steatosis, and decreased mitochondria in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Sesn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Sesn3 APN 9 14321142 missense probably damaging 1.00
IGL01396:Sesn3 APN 9 14321078 missense probably benign 0.43
IGL01925:Sesn3 APN 9 14320400 missense probably damaging 1.00
IGL02016:Sesn3 APN 9 14320337 missense probably damaging 1.00
IGL02498:Sesn3 APN 9 14306268 splice site probably benign
IGL02892:Sesn3 APN 9 14314734 critical splice donor site probably null
IGL02933:Sesn3 APN 9 14321208 missense probably damaging 1.00
IGL03112:Sesn3 APN 9 14310261 missense probably damaging 1.00
R0591:Sesn3 UTSW 9 14308558 missense probably damaging 0.96
R1450:Sesn3 UTSW 9 14316224 missense possibly damaging 0.80
R1495:Sesn3 UTSW 9 14308521 missense probably damaging 0.98
R1897:Sesn3 UTSW 9 14308645 missense probably damaging 1.00
R2237:Sesn3 UTSW 9 14308465 missense probably benign
R2238:Sesn3 UTSW 9 14308465 missense probably benign
R4209:Sesn3 UTSW 9 14306209 missense probably benign 0.12
R4352:Sesn3 UTSW 9 14320373 missense probably damaging 0.99
R4535:Sesn3 UTSW 9 14322658 missense probably benign 0.05
R4572:Sesn3 UTSW 9 14321220 missense probably benign 0.03
R6261:Sesn3 UTSW 9 14321163 missense probably benign 0.27
R6304:Sesn3 UTSW 9 14322561 critical splice acceptor site probably null
R6741:Sesn3 UTSW 9 14320340 missense possibly damaging 0.72
R6906:Sesn3 UTSW 9 14325641 missense probably damaging 0.98
R6988:Sesn3 UTSW 9 14310257 nonsense probably null
R7289:Sesn3 UTSW 9 14276552 start codon destroyed probably benign
R7318:Sesn3 UTSW 9 14308577 missense probably damaging 0.96
R7646:Sesn3 UTSW 9 14308615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCATGGGTTCTCACTGG -3'
(R):5'- ATCATTCACTTTCATGGCCATG -3'

Sequencing Primer
(F):5'- ACCATGGGTTCTCACTGGTGAAC -3'
(R):5'- TAGCCCCAAACAGGCTAT -3'
Posted On2018-06-06