Mutagenetix > Incidental Mutations

Incidental Mutation 'R6556:Igsf9b'

522174

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.460) question?

Stock #

R6556 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27329555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 688 (F688S)

Ref Sequence

ENSEMBL: ENSMUSP00000149356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

AlphaFold

E9PZ19

Predicted Effect

probably damaging
Transcript: ENSMUST00000115247
AA Change: F684S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: F684S

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133213
AA Change: F684S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: F684S

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214187

Predicted Effect

probably damaging
Transcript: ENSMUST00000214357
AA Change: F688S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029P11Rik	A	G	15: 81,980,738	D60G	probably damaging	Het
2310035C23Rik	T	A	1: 105,726,440	F845I	probably damaging	Het
4930539E08Rik	T	A	17: 28,904,611	D114V	probably damaging	Het
AF366264	G	A	8: 13,837,690	Q134*	probably null	Het
Atp2a1	G	T	7: 126,450,262	P536Q	probably benign	Het
Cabyr	T	A	18: 12,751,016	S187T	probably benign	Het
Camkk1	A	T	11: 73,033,870	N303I	probably benign	Het
Cdh13	C	T	8: 118,968,187	P259S	probably damaging	Het
Csnk1g3	A	G	18: 53,930,282	D255G	possibly damaging	Het
Dennd5b	A	C	6: 149,014,251		probably null	Het
Dnajc14	A	G	10: 128,814,631	D528G	probably benign	Het
Edem1	T	C	6: 108,854,357	F593S	probably benign	Het
Erbb2	G	A	11: 98,436,082	D1106N	possibly damaging	Het
Ermp1	T	C	19: 29,612,921	M794V	possibly damaging	Het
Fam208a	T	G	14: 27,429,258	Y64D	probably benign	Het
Fam214b	C	T	4: 43,033,896	R460H	probably damaging	Het
Fip1l1	T	A	5: 74,547,177		probably null	Het
Gm11639	A	G	11: 105,008,251	N4343S	probably null	Het
Gm20730	C	T	6: 43,081,542	C112Y	probably damaging	Het
Gtf2h1	T	A	7: 46,808,665	C245S	probably damaging	Het
Hdhd5	T	C	6: 120,523,554	H61R	probably benign	Het
Ighv1-71	A	T	12: 115,742,472	V31E	probably damaging	Het
Iqcd	T	C	5: 120,602,378	V258A	probably damaging	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Lpo	G	T	11: 87,817,763	Y136*	probably null	Het
Med30	A	G	15: 52,730,383		probably benign	Het
Mertk	T	A	2: 128,776,421	V524D	probably benign	Het
Olfr1156	T	C	2: 87,949,976	I86V	probably benign	Het
Olfr1261	T	A	2: 89,994,173	F260Y	probably benign	Het
Olfr1263	T	C	2: 90,015,094	Y55H	probably damaging	Het
Pde6b	T	A	5: 108,421,501	M358K	possibly damaging	Het
Prep	GA	G	10: 45,158,314		probably null	Het
Prpf4b	G	A	13: 34,896,032	R793Q	probably damaging	Het
Rela	T	A	19: 5,647,338	N524K	probably damaging	Het
Rnaset2a	T	C	17: 8,141,648	D74G	probably damaging	Het
Serinc2	T	A	4: 130,258,271	I267F	probably damaging	Het
Sesn3	T	C	9: 14,321,253	F274S	possibly damaging	Het
Spag1	T	C	15: 36,195,407	Y249H	probably damaging	Het
Sstr1	A	T	12: 58,213,692	D367V	possibly damaging	Het
Tnnt1	T	C	7: 4,509,577	E110G	probably damaging	Het
Tpm1	T	A	9: 67,028,169		probably null	Het
Unc93b1	T	C	19: 3,944,105	V412A	probably benign	Het
Uox	G	C	3: 146,624,648		probably null	Het
Usp44	T	C	10: 93,846,008	Y107H	probably benign	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
G1Funyon:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
R8301:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
R8546:Igsf9b	UTSW	9	27333130	missense	possibly damaging	0.54
R8553:Igsf9b	UTSW	9	27333443	missense	probably damaging	0.96
R9438:Igsf9b	UTSW	9	27332543	missense	probably benign	0.03
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGGCTTCATGTGCATAC -3'
(R):5'- GCTTAAGCTTTCAGCCCAGC -3'

Sequencing Primer
(F):5'- CCATAGCTTGAATACCGGTGG -3'
(R):5'- AGCTTGTCCTCCCAGATTAGCTG -3'

Posted On

2018-06-06