Incidental Mutation 'R6529:Slc25a13'
ID522176
Institutional Source Beutler Lab
Gene Symbol Slc25a13
Ensembl Gene ENSMUSG00000015112
Gene Namesolute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonymscitrin, Ctrn
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location6041218-6217173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6073451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 469 (V469A)
Ref Sequence ENSEMBL: ENSMUSP00000139571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015256] [ENSMUST00000188414]
Predicted Effect probably benign
Transcript: ENSMUST00000015256
AA Change: V469A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000015256
Gene: ENSMUSG00000015112
AA Change: V469A

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 5.2e-27 PFAM
Pfam:Mito_carr 425 516 1.2e-17 PFAM
Pfam:Mito_carr 517 612 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188414
AA Change: V469A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139571
Gene: ENSMUSG00000015112
AA Change: V469A

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 2.6e-26 PFAM
Pfam:Mito_carr 425 516 4.4e-19 PFAM
Pfam:Mito_carr 517 612 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203551
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene appear normal, healthy and fertile, although they have a number of metabolic defects, but the spontaneous hyperspin deletion spanning from intron 3 to exon 17 also eliminates a modifier of Dlx5 causing a recessive vestibular and mortality phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Slc25a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Slc25a13 APN 6 6042739 critical splice donor site probably null
IGL02237:Slc25a13 APN 6 6042646 missense probably damaging 1.00
IGL02285:Slc25a13 APN 6 6042643 missense possibly damaging 0.95
IGL02287:Slc25a13 APN 6 6216992 splice site probably benign
IGL02593:Slc25a13 APN 6 6042265 missense probably benign 0.00
R0028:Slc25a13 UTSW 6 6181047 missense probably benign 0.10
R0045:Slc25a13 UTSW 6 6109277 missense probably benign 0.05
R0384:Slc25a13 UTSW 6 6042600 nonsense probably null
R0711:Slc25a13 UTSW 6 6117128 missense probably damaging 0.99
R1299:Slc25a13 UTSW 6 6113937 critical splice donor site probably null
R1625:Slc25a13 UTSW 6 6096675 missense probably damaging 1.00
R1701:Slc25a13 UTSW 6 6152525 critical splice acceptor site probably null
R1792:Slc25a13 UTSW 6 6115104 missense possibly damaging 0.79
R1932:Slc25a13 UTSW 6 6042264 missense probably benign 0.33
R1933:Slc25a13 UTSW 6 6109262 missense probably damaging 1.00
R1952:Slc25a13 UTSW 6 6152482 missense probably damaging 1.00
R1969:Slc25a13 UTSW 6 6096668 critical splice donor site probably null
R2027:Slc25a13 UTSW 6 6073487 missense probably damaging 1.00
R2074:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2432:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2508:Slc25a13 UTSW 6 6117190 missense probably benign 0.06
R3774:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R3775:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R4804:Slc25a13 UTSW 6 6109213 missense probably damaging 1.00
R4816:Slc25a13 UTSW 6 6114274 missense possibly damaging 0.71
R4978:Slc25a13 UTSW 6 6042300 missense probably damaging 0.97
R6615:Slc25a13 UTSW 6 6073454 missense probably damaging 1.00
R6709:Slc25a13 UTSW 6 6073440 missense possibly damaging 0.88
R7346:Slc25a13 UTSW 6 6181100 missense possibly damaging 0.67
R7571:Slc25a13 UTSW 6 6052785 missense probably damaging 1.00
R7807:Slc25a13 UTSW 6 6117164 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGCAATTTGCTGGCAGATG -3'
(R):5'- GAGTTATCTGAGACCATCAATCCATG -3'

Sequencing Primer
(F):5'- CAATTTGCTGGCAGATGGTAGGAG -3'
(R):5'- CAATCCATGGTGATGAATATCCC -3'
Posted On2018-06-06