Incidental Mutation 'R6556:Tpm1'
ID 522177
Institutional Source Beutler Lab
Gene Symbol Tpm1
Ensembl Gene ENSMUSG00000032366
Gene Name tropomyosin 1, alpha
Synonyms TM2, Tpm-1, alpha-TM, Tm3
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6556 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 66929872-66956688 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 66935451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030185] [ENSMUST00000034928] [ENSMUST00000050905] [ENSMUST00000113684] [ENSMUST00000113685] [ENSMUST00000113686] [ENSMUST00000113687] [ENSMUST00000113701] [ENSMUST00000113696] [ENSMUST00000129733] [ENSMUST00000113689] [ENSMUST00000113690] [ENSMUST00000113697] [ENSMUST00000113707] [ENSMUST00000113695] [ENSMUST00000113705] [ENSMUST00000113693] [ENSMUST00000139046]
AlphaFold P58771
Predicted Effect probably benign
Transcript: ENSMUST00000030185
SMART Domains Protein: ENSMUSP00000030185
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.7e-39 PFAM
Pfam:Tropomyosin 48 284 1.7e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034928
SMART Domains Protein: ENSMUSP00000034928
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:Tropomyosin_1 56 195 4.1e-29 PFAM
Pfam:Tropomyosin 90 326 5.9e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000050905
SMART Domains Protein: ENSMUSP00000051888
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 5.1e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113684
SMART Domains Protein: ENSMUSP00000109314
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 248 8.1e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113685
SMART Domains Protein: ENSMUSP00000109315
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 3.1e-102 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113686
SMART Domains Protein: ENSMUSP00000109316
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 2.9e-23 PFAM
Pfam:Tropomyosin 12 228 8.4e-92 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113687
SMART Domains Protein: ENSMUSP00000109317
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.4e-40 PFAM
Pfam:Tropomyosin 48 264 1.8e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113701
SMART Domains Protein: ENSMUSP00000109331
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 1.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113696
SMART Domains Protein: ENSMUSP00000109326
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 2.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129733
SMART Domains Protein: ENSMUSP00000138784
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 4e-36 PFAM
Pfam:Tropomyosin 48 128 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113689
SMART Domains Protein: ENSMUSP00000109319
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 244 8.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113690
SMART Domains Protein: ENSMUSP00000109320
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 5.9e-23 PFAM
Pfam:Tropomyosin 12 244 8.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113697
SMART Domains Protein: ENSMUSP00000109327
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113707
SMART Domains Protein: ENSMUSP00000109337
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129466
Predicted Effect probably benign
Transcript: ENSMUST00000113695
SMART Domains Protein: ENSMUSP00000109325
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113705
SMART Domains Protein: ENSMUSP00000109335
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 9.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113693
SMART Domains Protein: ENSMUSP00000109323
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.1e-37 PFAM
Pfam:Tropomyosin 48 280 8.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156899
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atosb C T 4: 43,033,896 (GRCm39) R460H probably damaging Het
Atp2a1 G T 7: 126,049,434 (GRCm39) P536Q probably benign Het
Bnip5 T A 17: 29,123,585 (GRCm39) D114V probably damaging Het
Cabyr T A 18: 12,884,073 (GRCm39) S187T probably benign Het
Camkk1 A T 11: 72,924,696 (GRCm39) N303I probably benign Het
Cdh13 C T 8: 119,694,926 (GRCm39) P259S probably damaging Het
Csnk1g3 A G 18: 54,063,354 (GRCm39) D255G possibly damaging Het
Dennd5b A C 6: 148,915,749 (GRCm39) probably null Het
Dnajc14 A G 10: 128,650,500 (GRCm39) D528G probably benign Het
Edem1 T C 6: 108,831,318 (GRCm39) F593S probably benign Het
Efcab3 A G 11: 104,899,077 (GRCm39) N4343S probably null Het
Erbb2 G A 11: 98,326,908 (GRCm39) D1106N possibly damaging Het
Ermp1 T C 19: 29,590,321 (GRCm39) M794V possibly damaging Het
Fip1l1 T A 5: 74,707,838 (GRCm39) probably null Het
Gm20730 C T 6: 43,058,476 (GRCm39) C112Y probably damaging Het
Gtf2h1 T A 7: 46,458,089 (GRCm39) C245S probably damaging Het
Hdhd5 T C 6: 120,500,515 (GRCm39) H61R probably benign Het
Ighv1-71 A T 12: 115,706,092 (GRCm39) V31E probably damaging Het
Igsf9b T C 9: 27,240,851 (GRCm39) F688S probably damaging Het
Iqcd T C 5: 120,740,443 (GRCm39) V258A probably damaging Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Lpo G T 11: 87,708,589 (GRCm39) Y136* probably null Het
Med30 A G 15: 52,593,779 (GRCm39) probably benign Het
Mertk T A 2: 128,618,341 (GRCm39) V524D probably benign Het
Ndufb11b A G 15: 81,864,939 (GRCm39) D60G probably damaging Het
Or4c126 T A 2: 89,824,517 (GRCm39) F260Y probably benign Het
Or4c52 T C 2: 89,845,438 (GRCm39) Y55H probably damaging Het
Or5l13 T C 2: 87,780,320 (GRCm39) I86V probably benign Het
Pde6b T A 5: 108,569,367 (GRCm39) M358K possibly damaging Het
Prep GA G 10: 45,034,410 (GRCm39) probably null Het
Prpf4b G A 13: 35,080,015 (GRCm39) R793Q probably damaging Het
Rela T A 19: 5,697,366 (GRCm39) N524K probably damaging Het
Relch T A 1: 105,654,165 (GRCm39) F845I probably damaging Het
Rnaset2a T C 17: 8,360,480 (GRCm39) D74G probably damaging Het
Semp2l2a G A 8: 13,887,690 (GRCm39) Q134* probably null Het
Serinc2 T A 4: 130,152,064 (GRCm39) I267F probably damaging Het
Sesn3 T C 9: 14,232,549 (GRCm39) F274S possibly damaging Het
Spag1 T C 15: 36,195,553 (GRCm39) Y249H probably damaging Het
Sstr1 A T 12: 58,260,478 (GRCm39) D367V possibly damaging Het
Tasor T G 14: 27,151,215 (GRCm39) Y64D probably benign Het
Tnnt1 T C 7: 4,512,576 (GRCm39) E110G probably damaging Het
Unc93b1 T C 19: 3,994,105 (GRCm39) V412A probably benign Het
Uox G C 3: 146,330,403 (GRCm39) probably null Het
Usp44 T C 10: 93,681,870 (GRCm39) Y107H probably benign Het
Other mutations in Tpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tpm1 APN 9 66,943,337 (GRCm39) missense probably damaging 1.00
IGL01288:Tpm1 APN 9 66,943,337 (GRCm39) missense probably damaging 1.00
IGL01569:Tpm1 APN 9 66,938,390 (GRCm39) splice site probably null
R1137:Tpm1 UTSW 9 66,938,400 (GRCm39) splice site probably null
R1554:Tpm1 UTSW 9 66,930,711 (GRCm39) missense probably benign 0.04
R2012:Tpm1 UTSW 9 66,941,247 (GRCm39) nonsense probably null
R2898:Tpm1 UTSW 9 66,938,322 (GRCm39) missense probably damaging 1.00
R3723:Tpm1 UTSW 9 66,939,227 (GRCm39) intron probably benign
R3724:Tpm1 UTSW 9 66,939,227 (GRCm39) intron probably benign
R4172:Tpm1 UTSW 9 66,930,649 (GRCm39) missense probably benign 0.34
R4427:Tpm1 UTSW 9 66,939,847 (GRCm39) intron probably benign
R4934:Tpm1 UTSW 9 66,935,331 (GRCm39) splice site probably null
R5605:Tpm1 UTSW 9 66,956,317 (GRCm39) missense probably damaging 0.99
R5726:Tpm1 UTSW 9 66,930,694 (GRCm39) missense probably damaging 0.97
R6910:Tpm1 UTSW 9 66,939,256 (GRCm39) missense probably damaging 1.00
R7242:Tpm1 UTSW 9 66,935,383 (GRCm39) missense probably benign
R7386:Tpm1 UTSW 9 66,935,449 (GRCm39) missense probably benign
R8463:Tpm1 UTSW 9 66,955,512 (GRCm39) missense probably benign 0.01
R8755:Tpm1 UTSW 9 66,935,371 (GRCm39) missense probably benign 0.15
R9035:Tpm1 UTSW 9 66,955,138 (GRCm39) missense possibly damaging 0.53
R9294:Tpm1 UTSW 9 66,936,998 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCGAATTGCTTCTGTAC -3'
(R):5'- GGACCTGGCTTAAGCTTTGTTC -3'

Sequencing Primer
(F):5'- GGCGAATTGCTTCTGTACAATAG -3'
(R):5'- ATGTTTATGACTCTGCCTCAGG -3'
Posted On 2018-06-06