Incidental Mutation 'R6556:Tpm1'
ID522177
Institutional Source Beutler Lab
Gene Symbol Tpm1
Ensembl Gene ENSMUSG00000032366
Gene Nametropomyosin 1, alpha
SynonymsTM2, Tpm-1, alpha-TM, Tm3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location67022590-67049406 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 67028169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030185] [ENSMUST00000034928] [ENSMUST00000050905] [ENSMUST00000113684] [ENSMUST00000113685] [ENSMUST00000113686] [ENSMUST00000113687] [ENSMUST00000113689] [ENSMUST00000113690] [ENSMUST00000113693] [ENSMUST00000113695] [ENSMUST00000113696] [ENSMUST00000113701] [ENSMUST00000139046] [ENSMUST00000129733] [ENSMUST00000113697] [ENSMUST00000113707] [ENSMUST00000113705]
Predicted Effect probably benign
Transcript: ENSMUST00000030185
SMART Domains Protein: ENSMUSP00000030185
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.7e-39 PFAM
Pfam:Tropomyosin 48 284 1.7e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034928
SMART Domains Protein: ENSMUSP00000034928
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:Tropomyosin_1 56 195 4.1e-29 PFAM
Pfam:Tropomyosin 90 326 5.9e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000050905
SMART Domains Protein: ENSMUSP00000051888
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 5.1e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113684
SMART Domains Protein: ENSMUSP00000109314
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 248 8.1e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113685
SMART Domains Protein: ENSMUSP00000109315
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 3.1e-102 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113686
SMART Domains Protein: ENSMUSP00000109316
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 2.9e-23 PFAM
Pfam:Tropomyosin 12 228 8.4e-92 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113687
SMART Domains Protein: ENSMUSP00000109317
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.4e-40 PFAM
Pfam:Tropomyosin 48 264 1.8e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113689
SMART Domains Protein: ENSMUSP00000109319
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 244 8.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113690
SMART Domains Protein: ENSMUSP00000109320
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 5.9e-23 PFAM
Pfam:Tropomyosin 12 244 8.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113693
SMART Domains Protein: ENSMUSP00000109323
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.1e-37 PFAM
Pfam:Tropomyosin 48 280 8.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113695
SMART Domains Protein: ENSMUSP00000109325
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113696
SMART Domains Protein: ENSMUSP00000109326
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 2.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113701
SMART Domains Protein: ENSMUSP00000109331
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 1.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139046
Predicted Effect probably benign
Transcript: ENSMUST00000129733
SMART Domains Protein: ENSMUSP00000138784
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 4e-36 PFAM
Pfam:Tropomyosin 48 128 7.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156899
Predicted Effect probably benign
Transcript: ENSMUST00000113697
SMART Domains Protein: ENSMUSP00000109327
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113707
SMART Domains Protein: ENSMUSP00000109337
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129466
Predicted Effect probably benign
Transcript: ENSMUST00000113705
SMART Domains Protein: ENSMUSP00000109335
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 9.5e-95 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Tpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01288:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01569:Tpm1 APN 9 67031108 splice site probably null
R1137:Tpm1 UTSW 9 67031118 splice site probably null
R1554:Tpm1 UTSW 9 67023429 missense probably benign 0.04
R2012:Tpm1 UTSW 9 67033965 nonsense probably null
R2898:Tpm1 UTSW 9 67031040 missense probably damaging 1.00
R3723:Tpm1 UTSW 9 67031945 intron probably benign
R3724:Tpm1 UTSW 9 67031945 intron probably benign
R4172:Tpm1 UTSW 9 67023367 missense probably benign 0.34
R4427:Tpm1 UTSW 9 67032565 intron probably benign
R4934:Tpm1 UTSW 9 67028049 splice site probably null
R5605:Tpm1 UTSW 9 67049035 missense probably damaging 0.99
R5726:Tpm1 UTSW 9 67023412 missense probably damaging 0.97
R6910:Tpm1 UTSW 9 67031974 missense probably damaging 1.00
R7242:Tpm1 UTSW 9 67028101 missense probably benign
R7386:Tpm1 UTSW 9 67028167 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCGAATTGCTTCTGTAC -3'
(R):5'- GGACCTGGCTTAAGCTTTGTTC -3'

Sequencing Primer
(F):5'- GGCGAATTGCTTCTGTACAATAG -3'
(R):5'- ATGTTTATGACTCTGCCTCAGG -3'
Posted On2018-06-06