Incidental Mutation 'R6556:Lpo'
ID522189
Institutional Source Beutler Lab
Gene Symbol Lpo
Ensembl Gene ENSMUSG00000009356
Gene Namelactoperoxidase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87806428-87828289 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 87817763 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 136 (Y136*)
Ref Sequence ENSEMBL: ENSMUSP00000117763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103177] [ENSMUST00000136446]
Predicted Effect probably null
Transcript: ENSMUST00000103177
AA Change: Y136*
SMART Domains Protein: ENSMUSP00000099466
Gene: ENSMUSG00000009356
AA Change: Y136*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 136 682 1.8e-180 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136446
AA Change: Y136*
SMART Domains Protein: ENSMUSP00000117763
Gene: ENSMUSG00000009356
AA Change: Y136*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4OEK|A 116 145 4e-7 PDB
SCOP:g1cxp.1 130 145 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157004
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxidase family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Following its secretion from salivary, mammary, and other mucosal glands, this enzyme catalyzes the generation of the antimicrobial substance hypothiocyanous acid. This gene is present in a gene cluster on chromosome 17. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Lpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Lpo APN 11 87821138 missense probably benign 0.43
IGL01833:Lpo APN 11 87807333 missense possibly damaging 0.81
IGL02413:Lpo APN 11 87806906 missense possibly damaging 0.87
IGL02706:Lpo APN 11 87817773 missense probably benign 0.02
IGL02865:Lpo APN 11 87806977 missense possibly damaging 0.80
IGL02939:Lpo APN 11 87815178 missense possibly damaging 0.85
R1072:Lpo UTSW 11 87818434 missense probably damaging 1.00
R1169:Lpo UTSW 11 87817317 missense possibly damaging 0.58
R1667:Lpo UTSW 11 87807241 unclassified probably benign
R1719:Lpo UTSW 11 87809192 unclassified probably null
R2133:Lpo UTSW 11 87821130 missense probably benign 0.17
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R4382:Lpo UTSW 11 87822201 missense probably benign 0.14
R4657:Lpo UTSW 11 87814347 missense probably damaging 1.00
R4936:Lpo UTSW 11 87810340 missense probably benign 0.02
R4969:Lpo UTSW 11 87806925 missense probably benign 0.09
R5368:Lpo UTSW 11 87821069 missense possibly damaging 0.61
R5536:Lpo UTSW 11 87816563 missense probably damaging 1.00
R6246:Lpo UTSW 11 87822232 missense unknown
R6817:Lpo UTSW 11 87809241 missense probably benign
R7024:Lpo UTSW 11 87816443 missense probably damaging 1.00
R7203:Lpo UTSW 11 87809251 missense possibly damaging 0.75
R7206:Lpo UTSW 11 87807423 missense probably damaging 1.00
RF010:Lpo UTSW 11 87821102 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTGCACTGTGAGCTTCTG -3'
(R):5'- ATGAAACTTGCATTCTCTTCTGGG -3'

Sequencing Primer
(F):5'- AAAATCTAGGACTGTCTGTGTAGTG -3'
(R):5'- CTTCTGGGTTACACCGAGCTG -3'
Posted On2018-06-06